Methods and compositions for managing vascular conditions

Abstract

This disclosure relates to methods and compositions for managing vascular conditions by targeting microRNA. In certain embodiments, the disclosure relates to antisense, RNA interference, and blocking oligonucleotide therapeutic compositions and uses related thereto.

1 . A composition comprising an isolated nucleobase polymer that binds miR-663 (SEQ ID NO: 1) CCUUCCGGCGUCCCAGGCGGGGCGCCGCGGGACCGCCCUCGUGUCUGUGGCG GUGGGAUCCCGCGGCCGUGUUUUCCUGGUGGCCCGGCCAUG wherein the nucleobase polymer binds sufficiently to prevent translation of tissue inhibitor of metalloproteinase 3 in vivo. 
     
     
         2 . The composition of  claim 1 , wherein the nucleobase polymer is a nucleic acid or nucleic acid mimetic that hybridizes to miR-663 (SEQ ID NO: 1). 
     
     
         3 . The composition of  claims 1 - 2 , wherein the nucleobase polymer comprises monomers of phosphodiester, phosphorothioate, methylphosphonate, phosphorodiamidate, piperazine phosphorodiamidate, ribose, 2′-O-methy ribose, 2′-O-methoxyethyl ribose, 2′-fluororibose, deoxyribose, 1-(hydroxymethyl)-2,5-dioxabicyclo[2.2.1]heptan-7-ol, P-(2-(hydroxymethyl)morpholino)-N,N-dimethylphosphonamidate, morpholin-2-ylmethanol, (2-(hydroxymethyl)morpholino) (piperazin-1-yl)phosphinate, or peptide nucleic acids and combinations thereof. 
     
     
         4 . The composition of  claims 1 - 3 , wherein the nucleobase polymer is 3′ or 5′ terminally conjugated to a hydrocarbon, polyethylene glycol, saccharide, polysaccharide, cell penetrating peptide, or combinations thereof. 
     
     
         5 . The composition of  claim 4 , wherein the cells penetrating peptide is a positively charged peptide, arginine-rich peptide, oligoarginine peptide (7-12), or octa-arginine (R8). 
     
     
         6 . The composition of  claims 1 - 5 , wherein the nucleobase polymer comprises 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or more nucleobases. 
     
     
         7 . The composition of  claims 1 - 6 , wherein the nucleobase polymer comprises 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or more continuous nucleobases that hybridize SEQ ID NO:1. 
     
     
         8 . A particle comprising an ionizable or cationic core comprising the nucleobase polymer of  claims 1 - 7 . 
     
     
         9 . A pharmaceutical composition comprising the nucleobase polymer of  claims 1 - 7  or a particle of  claim 8 , and a pharmaceutically acceptable excipient. 
     
     
         10 . A method of treating or preventing a vascular disease comprising administering an effective amount of a pharmaceutical composition of  claim 9  to a subject in need thereof. 
     
     
         11 . The method of  claim 10 , wherein the subject is a human. 
     
     
         12 . The method of  claim 10 , wherein the subject is at risk of, exhibiting symptoms of, or diagnosed with atherosclerosis, peripheral vascular disease, coronary heart disease, heart failure, right ventricular hypertrophy, cardiac dysrhythmia, endocarditis, inflammatory cardiomegaly, myocarditis, vascular heart disease, stroke, cerebrovascular disease, or peripheral arterial disease. 
     
     
         13 . The method of  claim 10 , wherein the subject has type I or type II diabetes, impaired glucose tolerance, elevated serum C-reactive protein concentration, vitamin B6 deficiency, dietary iodine deficiency, hypothyroidism, hyperlipidemia, hypertension, or is older than 50 years old, or smokes cigarettes daily. 
     
     
         14 . The method of  claim 10 , wherein the pharmaceutical composition is administered in combination with a statin, atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin, ezetimibe, amlodipine, niacin, aspirin, omega-3 fatty acid, or combinations thereof. 
     
     
         15 . A compositions comprising a double stranded RNAi consisting of between 15 and 30 continuous nucleotides of SEQ ID NO:1. 
     
     
         16 . The composition of  claim 15 , wherein the double stranded RNAi is 3′ end capped with one or more thymidine nucleotides and/or the passenger strand of the RNAi comprises 5′ end polyphophosphate. 
     
     
         17 . A particle comprising a hydrophilic or lipid membrane and ionizable or cationic core comprising the double stranded RNAi of  claim 16 . 
     
     
         18 . A pharmaceutical composition comprising the RNAi of  claims 15 - 16  or a particle of  claim 17 , and a pharmaceutically acceptable excipient. 
     
     
         19 . A method of treating or preventing a vascular disease comprising administering an effective amount of a pharmaceutical composition of  claim 17  or  18  to a subject in need thereof. 
     
     
         20 . The method of  claim 10 , wherein the subject is at risk of, exhibiting symptoms of, or diagnosed with atherosclerosis, peripheral vascular disease, coronary heart disease, heart failure, right ventricular hypertrophy, cardiac dysrhythmia, endocarditis, inflammatory cardiomegaly, myocarditis, vascular heart disease, stroke, cerebrovascular disease, or peripheral arterial disease. 
     
     
         21 . A composition comprising an isolated nucleobase polymer that binds miR-205 (SEQ ID NO: 11) AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGU CUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA wherein the nucleobase polymer binds sufficiently to prevent translation of tissue inhibitor of metalloproteinase 3 in vivo. 
     
     
         22 . The composition of  claim 21 , wherein the nucleobase polymer is a nucleic acid or nucleic acid mimetic that hybridizes to miR-205 (SEQ ID NO: 11). 
     
     
         23 . The composition of  claims 21 - 22 , wherein the nucleobase polymer comprises monomers of phosphodiester, phosphorothioate, methylphosphonate, phosphorodiamidate, piperazine phosphorodiamidate, ribose, 2′-O-methy ribose, 2′-O-methoxyethyl ribose, 2′-fluororibose, deoxyribose, 1-(hydroxymethyl)-2,5-dioxabicyclo[2.2.1]heptan-7-ol, P-(2-(hydroxymethyl)morpholino)-N,N-dimethylphosphonamidate, morpholin-2-ylmethanol, (2-(hydroxymethyl)morpholino) (piperazin-1-yl)phosphinate, or peptide nucleic acids and combinations thereof. 
     
     
         24 . The composition of  claims 21 - 23 , wherein the nucleobase polymer is 3′ or 5′ terminally conjugated to a hydrocarbon, polyethylene glycol, saccharide, polysaccharide, cell penetrating peptide, or combinations thereof. 
     
     
         25 . The composition of  claim 24 , wherein the cells penetrating peptide is a positively charged peptide, arginine-rich peptide, oligoarginine peptide (7-12), or octa-arginine (R8). 
     
     
         26 . The composition of  claims 21 - 25 , wherein the nucleobase polymer comprises 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or more nucleobases. 
     
     
         27 . The composition of  claims 21 - 26 , wherein the nucleobase polymer comprises 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 or more continuous nucleobases that hybridize SEQ ID NO:11. 
     
     
         28 . A particle comprising an ionizable or cationic core comprising the nucleobase polymer of  claims 21 - 27 . 
     
     
         29 . A pharmaceutical composition comprising the nucleobase polymer of  claims 21 - 27  or a particle of  claim 28 , and a pharmaceutically acceptable excipient. 
     
     
         30 . A method of treating or preventing a vascular disease comprising administering an effective amount of a pharmaceutical composition of  claim 29  to a subject in need thereof. 
     
     
         31 . The method of  claim 30 , wherein the subject is a human. 
     
     
         32 . The method of  claim 30 , wherein the subject is at risk of, exhibiting symptoms of, or diagnosed with atherosclerosis, peripheral vascular disease, coronary heart disease, heart failure, right ventricular hypertrophy, cardiac dysrhythmia, endocarditis, inflammatory cardiomegaly, myocarditis, vascular heart disease, stroke, cerebrovascular disease, or peripheral arterial disease. 
     
     
         33 . The method of  claim 30 , wherein the subject has type I or type II diabetes, impaired glucose tolerance, elevated serum C-reactive protein concentration, vitamin B6 deficiency, dietary iodine deficiency, hypothyroidism, hyperlipidemia, hypertension, or is older than 50 years old, or smokes cigarettes daily. 
     
     
         34 . The method of  claim 30 , wherein the pharmaceutical composition is administered in combination with a statin, atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin, ezetimibe, amlodipine, niacin, aspirin, omega-3 fatty acid, or combinations thereof. 
     
     
         35 . A compositions comprising a double stranded RNA consisting of between 15 and 30 continuous nucleotides of SEQ ID NO:11. 
     
     
         36 . The composition of  claim 35 , wherein the double stranded RNA is 3′ end capped with one or more thymidine nucleotides and/or the passenger strand of the RNA comprises 5′ end polyphophosphate. 
     
     
         37 . A particle comprising a hydrophilic or lipid membrane and ionizable or cationic core comprising the double stranded RNA of  claim 36 . 
     
     
         38 . A pharmaceutical composition comprising the RNA of  claims 35 - 36  or a particle of  claim 37 , and a pharmaceutically acceptable excipient. 
     
     
         39 . A method of treating or preventing a vascular disease comprising administering an effective amount of a pharmaceutical composition of  claim 37  or  38  to a subject in need thereof. 
     
     
         40 . The method of  claim 30 , wherein the subject is at risk of, exhibiting symptoms of, or diagnosed with atherosclerosis, peripheral vascular disease, coronary heart disease, heart failure, right ventricular hypertrophy, cardiac dysrhythmia, endocarditis, inflammatory cardiomegaly, myocarditis, vascular heart disease, stroke, cerebrovascular disease, peripheral arterial disease, or cancer. 
     
     
         41 . A vascular or non-vascular medical device coated or conjugated with the inhibitor of miR-205, miR-712, or miR-663. 
     
     
         42 . The medical device of  claim 41 , wherein the inhibitor is linked to polymers on the surface of the device. 
     
     
         43 . The medical device of  claim 41 , wherein the inhibitor is integrated to release with biodegradable polymer. 
     
     
         44 . The medical device of  claim 41  selected from a stents, pace maker, guide wire, delivery balloon, catheter, bioresorbable vascular scaffold, embolic protection device. 
     
     
         45 . The medical device of  claim 41 , wherein the inhibitor is a nucleobase polymer.