US2015361424A1PendingUtilityA1

Induction of exon skipping in eukaryotic cells

Assignee: ACADEMISCH ZIEKENHUIS LEIDENPriority: Sep 21, 2000Filed: Aug 28, 2015Published: Dec 17, 2015
Est. expirySep 21, 2020(expired)· nominal 20-yr term from priority
A61P 35/04A61P 5/14A61P 7/04A61P 35/00A61P 25/00A61P 31/12A61P 19/04A61P 21/04C12N 15/113A01K 2267/03A61K 48/005C12N 2310/315A61K 9/127C12N 2310/346A61K 48/00C12N 15/86A61K 31/7088C12N 2320/33C12N 15/11C12N 2750/14142C12N 2310/11C12N 2310/321
57
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, by inducing so-call exon skipping in the cell. Exon-skipping results in mature mRNA that does not contain the skipped exon, which leads to an altered product of the exon codes for amino acids. Exon skipping is performed by providing a cell with an agent capable of specifically inhibiting an exon inclusion signal, for instance, an exon recognition sequence, of the exon. The exon inclusion signal can be interfered with by a nucleic acid comprising complementarity to a part of the exon. The nucleic acid, which is also herewith provided, can be used for the preparation of a medicament, for instance, for the treatment of an inherited disease.

Claims

exact text as granted — not AI-modified
1 . A nucleic acid delivery vehicle comprising a liposome and the antisense oligonucleotide of  claim 6 , or the complement thereof. 
     
     
         2 . A nucleic acid delivery vehicle comprising or expressing the antisense oligonucleotide of  claim 6 . 
     
     
         3 . A non-human animal provided with the compound of  claim 6 . 
     
     
         4 . The composition of  claim 15 , wherein the oligonucleotide consists of between 15 to 25 nucleotides. 
     
     
         5 . The nucleic acid delivery vehicle of  claim 17 , wherein the oligonucleotide consists of between 15 to 25 nucleotides. 
     
     
         6 . An antisense-oligonucleotide comprising a nucleic acid sequence selected from the group consisting of 
       
         
           
                 
                 
               
                     
                   hAON#4: 
                 
                     
                   (SEQ ID NO: 11) 
                 
                     
                   5′ CTGCTTCCTCCAACC, 
                 
                     
                     
                 
                     
                   hAON#6: 
                 
                     
                   (SEQ ID NO: 12) 
                 
                     
                   5′ GTTATCTGCTTCCTCCAACC, 
                 
                     
                     
                 
                     
                   hAON#8: 
                 
                     
                   (SEQ ID NO: 13) 
                 
                     
                   5′ GCTTTTCTTTTAGTTGCTGC, 
                 
                     
                     
                 
                     
                   hAON#9: 
                 
                     
                   (SEQ ID NO: 14) 
                 
                     
                   5′ TTAGTTGCTGCTCTT, 
                 
                     
                     
                 
                     
                   hAON#11: 
                 
                     
                   (SEQ ID NO: 15) 
                 
                     
                   5′ TTGCTGCTCTTTTCC, 
                 
                     
                     
                 
                     
                   hAON#21: 
                 
                     
                   (SEQ ID NO: 16) 
                 
                     
                   5′ CCACAGGTTGTGTCACCAG, 
                 
                     
                     
                 
                     
                   hAON#22: 
                 
                     
                   (SEQ ID NO: 17) 
                 
                     
                   5′ TTTCCTTAGTAACCACAGGTT, 
                 
                     
                     
                 
                     
                   hAON#23: 
                 
                     
                   (SEQ ID NO: 18) 
                 
                     
                   5′ TGGCATTTCTAGTTTGG, 
                 
                     
                     
                 
                     
                   hAON#24: 
                 
                     
                   (SEQ ID NO: 19) 
                 
                     
                   5′ CCAGAGCAGGTACCTCCAACATC, 
                 
                     
                     
                 
                     
                   hAON#25: 
                 
                     
                   (SEQ ID NO: 20) 
                 
                     
                   5′ GGTAAGTTCTGTCCAAGCCC, 
                 
                     
                     
                 
                     
                   hAON#26: 
                 
                     
                   (SEQ ID NO: 21) 
                 
                     
                   5′ TCACCCTCTGTGATTTTAT, 
                 
                     
                     
                 
                     
                   hAON#27: 
                 
                     
                   (SEQ ID NO: 22) 
                 
                     
                   5′ CCCTCTGTGATTTT, 
                 
                     
                     
                 
                     
                   hAON#28: 
                 
                     
                   (SEQ ID NO: 23) 
                 
                     
                   5′ TCACCCACCATCACCCT, 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   hAON#30: 
                 
                     
                   (SEQ ID NO: 25) 
                 
                     
                   5′ CTGCTTGATGATCATCTCGTT, 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         7 . The antisense-oligonucleotide of  claim 6 , containing 14-40 nucleotides. 
     
     
         8 . A nucleic acid delivery vehicle comprising a transcription unit capable of expressing the antisense-oligonucleotide of  claim 6 . 
     
     
         9 . The nucleic acid delivery vehicle of  claim 8 , wherein the nucleic acid delivery vehicle is a single stranded virus. 
     
     
         10 . The nucleic acid delivery vehicle of  claim 9 , wherein said single stranded virus comprises an adeno-associated virus. 
     
     
         11 . An antisense oligonucleotide consisting of hAON#29: 5′ TGATATCCTCAAGGTCACCC (SEQ ID NO: 24), comprising a modification for increasing its resistance to an endonucleases in a cell. 
     
     
         12 . The oligonucleotide of  claim 13 , wherein said oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide or a peptide nucleic acid. 
     
     
         13 . An antisense oligonucleotide consisting of 14 to 40 nucleotides, comprising a modification, said oligonucleotide being complementary only to the interior of an exon selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53 of a dystrophin pre-mRNA, wherein said oligonucleotide induces skipping of said exon in a muscle cell of a Duchenne muscular dystrophy patient or a Becker Muscular Dystrophy patient. 
     
     
         14 . The oligonucleotide of  claim 13 , wherein the modification confers resistance to an endonuclease. 
     
     
         15 . A composition comprising the oligonucleotide of  claim 13 . 
     
     
         16 . The composition of  claim 15 , further comprising a second antisense oligonucleotide consisting of 14 to 40 nucleotides comprising a modification, said oligonucleotide being complementary only to the interior of an exon selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53 of a dystrophin pre-mRNA, wherein said oligonucleotide induces skipping of said exon in a muscle cell of a Duchenne muscular dystrophy patient or a Becker muscular dystrophy patient. 
     
     
         17 . A nucleic acid delivery vehicle comprising a transcription unit expressing an antisense oligonucleotide consisting of 14 to 40 nucleotides said oligonucleotide being complementary only to the interior of an exon selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53 of a dystrophin pre-mRNA, wherein said oligonucleotide induces skipping of said exon in a muscle cell of a Duchenne muscular dystrophy patient or a Becker Muscular Dystrophy patient. 
     
     
         18 . The oligonucleotide of  claim 13 , wherein said oligonucleotide comprises a modified base, and/or a modified sugar moiety and/or a modified internucleoside linkage. 
     
     
         19 . A pharmaceutical formulation comprising the oligonucleotide of  claim 13  and a pharmaceutically acceptable vehicle. 
     
     
         20 . The pharmaceutical formulation of  claim 19 , wherein said oligonucleotide does not comprise a detectable label. 
     
     
         21 . The oligonucleotide of  claim 13 , where said oligonucleotide comprises a sequence complementary to an exon recognition sequence. 
     
     
         22 . A nucleic acid delivery vehicle comprising a packaging agent and the antisense oligonucleotide of  claim 13 , or the complement thereof. 
     
     
         23 . A method for directing splicing of a dystrophin pre-mRNA in a muscle cell of a Duchenne muscular dystrophy patient or a Becker muscular dystrophy patient to produce a dystrophin protein comprising:
 providing said muscle cell with an antisense oligonucleotide consisting of 14-40 nucleotides,   wherein said oligonucleotide consists of a sequence complementary only to the interior of an exon of the dystrophin pre-mRNA selected from the group consisting of exon 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 and 53, and   wherein said oligonucleotide induces skipping of said exon of said dystrophin pre-mRNA in said muscle cell.   
     
     
         24 . The method of  claim 23 , wherein the dystrophin pre-mRNA comprises a deletion of one or more exons selected from the group consisting of: exons 3-7, exons 4-7, exons 5-7, exons 6-7, exons 18-44, exons 35-43, exon 44, exons 44-47, exon 45, exons 45-54, exons 45-52, exon 50, exons 50-52, exons 45-50, exons 46-47, exons 46-48, exons 46-49, exons 46-51, exons 46-53, exons 48-52, exons 48-50, exons 49-50, exons 49-52, exon 52, exons 52-63, exon 51, exons 51-55, exon 53, and exons 53-55. 
     
     
         25 . The method of  claim 23 , wherein mRNA produced from skipping of an exon of the dystrophin pre-mRNA encodes a functional dystrophin protein. 
     
     
         26 . The method of  claim 25 , wherein the functional dystrophin protein comprises a mutant dystrophin protein or a wild type dystrophin protein produced from translation of said mRNA. 
     
     
         27 . The method of  claim 26 , wherein the mutant dystrophin protein is a dystrophin protein of a Becker muscular dystrophy patient. 
     
     
         28 . The method of  claim 23 , wherein the oligonucleotide comprises a modification. 
     
     
         29 . The method of  claim 23 , wherein the oligonucleotide is a 2′-O-methyl phosphorothioate oligoribonucleotide or a peptide nucleic acid. 
     
     
         30 . The method of  claim 23 , wherein the oligonucleotide is a 2′-O-methyl-oligoribonucleotide and/or a 2′-O-methyl-phosphorothioate oligoribonucleotide. 
     
     
         31 . The method of  claim 23 , wherein the oligonucleotide comprises a modified base, and/or a modified sugar moiety and/or a modified internucleoside linkage.

Join the waitlist — get patent alerts

Track US2015361424A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.