Adam-15 antibodies and immunogenic peptides

Abstract

The present invention relates to antibodies and antigen-binding fragments thereof, immunogenic peptide(s), and siRNA molecules which are capable of inhibiting neovascularization and/or angiogenesis and endothelial cell proliferation. The invention relates to antibodies and antigen-binding fragments thereof with specificity towards the metalloprotease domain of ADAM 15 and to immunogenic peptide(s) that elicits such antibodies. The invention also relates to compositions and kits comprising the antibodies and immunogenic peptide(s) of the invention, as well as methods and uses of the antibodies and antigen-binding fragments thereof and immunogenic peptide(s), as well as siRNA molecules.

What is claimed is: 
     
         1 . An expression vector comprising a nucleic acid encoding an ribonucleic acid (RNA) interference molecule that specifically targets a human ADAM 15 nucleic acid and specifically inhibits expression of the human ADAM 15 nucleic acid, wherein the human ADAM 15 nucleic acid comprises sequence 5′ CTCCATCTGTTCTCCTGACTT 3′ (nucleotides 3-23 of SEQ ID NO: 4) and/or complementary sequence 5′ AAGTCAGGAGAACAGATGGAG 3′ (nucleotides 3-23 of SEQ ID NO: 5). 
     
     
         2 . The expression vector of  claim 1 , wherein the RNA molecule is selected from the group consisting of: microRNAs (miRNAs), short interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs) and short hairpin RNAs (shRNAs). 
     
     
         3 . The expression vector of  claim 1 , wherein the RNA interference molecule specifically targets sequence 5′ CTCCATCTGTTCTCCTGACTT 3′ (nucleotides 3-23 of SEQ ID NO: 4) and/or complementary sequence 5′ AAGTCAGGAGAACAGATGGAG 3′ (nucleotides 3-23 of SEQ ID NO: 5) of the human ADAM 15 nucleic acid. 
     
     
         4 . A cell comprising the expression vector of  claim 1 . 
     
     
         5 . An isolated monoclonal antibody, or antigen-binding fragment thereof, that specifically binds to the catalytic cleft of the ADAM15 metalloprotease domain. 
     
     
         6 . The isolated monoclonal antibody, or antigen-binding fragment thereof, of  claim 5 , wherein the monoclonal antibody, or antigen-binding fragment thereof, specifically inhibits ADAM15 metalloprotease activity. 
     
     
         7 . The isolated monoclonal antibody, or antigen-binding fragment thereof, of  claim 5 , wherein the antibody, or antigen-binding fragment thereof, is a mouse, humanized, recombinant, chimeric, or synthetic antibody or antigen-binding fragment thereof. 
     
     
         8 . The isolated monoclonal antibody, or antigen-binding fragment thereof, of  claim 5 , wherein the antibody, or antigen-binding fragment thereof, comprises Fab, Fab1, F(ab′)2, scFv, Fv, dsFv, ds-scFv, Fd, dAbs, TandAbs dimers, minibodies, diabodies, multimers thereof, or a bispecific antibody fragment. 
     
     
         9 . An expression vector comprising a nucleic acid encoding the isolated monoclonal antibody, or antigen binding fragment thereof, of  claim 5 . 
     
     
         10 . A host cell comprising the expression vector of  claim 9 . 
     
     
         11 . The isolated monoclonal antibody, or antigen-binding fragment thereof, of  claim 6 , wherein the antibody or antigen-binding fragment thereof is a mouse, humanized, recombinant, chimeric, or synthetic antibody or antigen-binding fragment thereof. 
     
     
         12 . The isolated monoclonal antibody, or antigen-binding fragment thereof, of  claim 6 , wherein the antibody, or antigen-binding fragment thereof, comprises Fab, Fab1, F(ab′)2, scFv, Fv, dsFv, ds-scFv, Fd, dAbs, TandAbs dimers, minibodies, diabodies, multimers thereof, or a bispecific antibody fragment. 
     
     
         13 . An expression vector comprising a nucleic acid encoding the isolated monoclonal antibody, or antigen binding fragment thereof, of  claim 6 . 
     
     
         14 . A host cell comprising the expression vector of  claim 13 .