US2015218552A1PendingUtilityA1
Rnai based selection system
Est. expiryFeb 11, 2029(~2.5 yrs left)· nominal 20-yr term from priority
Inventors:Peter Hahn
C12N 2310/14C12N 15/113C12N 15/1079C12N 15/67C12N 15/63C12N 2320/12C12N 15/1034C12N 15/64C12N 15/111
48
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present invention provides a novel RNAi based selection system for selecting host cells that have incorporated an expression vector.
Claims
exact text as granted — not AI-modifiedWhat is claimed is:
1 . A method for selecting a eukaryotic host cell that has been successfully transfected with an introduced expression vector, the method comprising:
a) providing a population of eukaryotic host cells that endogenously express at least one gene essential for cell survival; introducing said expression vector into said population of eukaryotic host cells, wherein said expression vector comprises at least one recombinant polynucleotide encoding a restoration product that is capable of restoring and/or maintaining cell viability when said gene essential for cell survival endogenously expressed by said eukaryotic host cells is targeted and down-regulated by an RNAi inducing compound used for selection; and c) culturing the population of eukaryotic host cells into which said expression vector has been introduced under selective conditions, wherein the selective conditions comprise at least the introduction of at least one RNAi inducing compound into said population of eukaryotic host cells, wherein said RNAi inducing compound is selected from the group consisting of (i) short interfering nucleic acids (siNA), (ii) short interfering RNAs (sRNA), (iii) microRNAs (miRNA), (iv) short hairpin RNAs (shRNA), and (v) precursors of (i)-(iv) that are processed in eukaryotic host cells into said RNAi inducing compound, wherein said RNAi inducing compound targets at least said gene essential for cell survival that is endogenously expressed by said eukaryotic host cells such that host cells that have not been successfully transfected with the expression vector are not able to survive the selective conditions, wherein the at least one gene essential for cell survival endogenously expressed by said population of eukaryotic host cells comprises ubiquitin, wherein said at least one RNAi inducing compound targets a sequence located in a 3′ untranslated region of a transcript of said at least one gene essential for cell survival that is endogenously expressed by said eukaryotic host cells, wherein the sequence of said at least one gene essential for cell survival endogenously expressed by said eukaryotic host cells that is targeted by said at least one RNAi inducing compound is selected from the group consisting of:
TAAAGGTTTCGTTGCATGGTA;
(SEQ ID NO: 1)
TCAGTAATAGCTGAACCTGTT;
(SEQ ID NO: 2)
GTGCCCAGTGATGGCATTACT;
(SEQ ID NO: 3)
AAGTTTAGAAATTACAAGTTT;
(SEQ ID NO: 4)
TTCAGTCATGGCATTCGCAGT;
(SEQ ID NO: 5)
TACTCTGCACTATAGCCATTT;
(SEQ ID NO: 6)
TTCAGTAATAGCTGAACCTGT;
(SEQ ID NO: 7)
TAATAGCTGAACCTGTTCAAA;
(SEQ ID NO: 8)
AAATGTTAATAAAGGTTTCGT;
(SEQ ID NO: 9)
GTTAATAAAGGTTTCGTTGCA;
(SEQ ID NO: 10)
TTAATAAAGGTTTCGTTGCAT;
(SEQ ID NO: 11)
and
GTAATAGCTGAACCTGTTCAA,
(SEQ ID NO: 12)
and
wherein the sequence of said at least one gene essential for cell survival endogenously expressed by said eukaryotic host cells that is targeted by said at least one RNAi inducing compound is not present in the recombinant polynucleotide encoding the restoration product.
2 . The method according to claim 1 , wherein said method includes at least one characteristic selected from the group consisting of:
a) at least one eukaryotic host cell is selected that survives the selective growth conditions; and b) the selective culture conditions comprise the introduction of at least one further RNAi inducing compound which targets a second gene essential for cell survival that is endogenously expressed by said eukaryotic host cell.
3 . The method according to claim 2 , wherein said method includes at least one characteristic selected from the group consisting of:
said recombinant polynucleotide that encodes the restoration product is an RNAi selectable marker gene that provides resistance to the RNAi inducing compound introduced into the eukaryotic host cell and which allows selection of eukaryotic host cells that have been successfully transfected with the introduced expression vector under the selection conditions; b) said expression vector comprises a further recombinant polynucleotide encoding a product which corresponds to a product of said second gene essential for cell survival that is endogenously expressed by said eukaryotic host cell; c) said expression vector comprises a further recombinant polynucleotide encoding a product of interest; d) said at least one recombinant polynucleotide is encompassed in an expression cassette; e) said at least one recombinant polynucleotide is encompassed in an expression cassette, wherein said expression cassette comprises at least one of the following elements:
i. a promoter and/or enhancer sequence functional in said eukaryotic host cells;
ii. a transcriptional termination signal;
iii. a poly A site;
iv. an intron; or
v. a secretory leader sequence;
f) said expression vector comprises at least one origin of replication; g) said expression vector comprises at least one additional selectable marker gene; and h) said recombinant polynucleotide that encodes the product which corresponds to the product encoded by said gene essential for cell survival that is endogenously expressed by said eukaryotic host cells is resistant to the RNAi inducing compound used for selection.
4 . The method according to claim 1 , wherein said eukaryotic host cells include at least one characteristic selected from the group consisting of:
a) the eukaryotic host cell is an insect cell; and b) the eukaryotic host cell is a mammalian cell.
5 . The method according to claim 1 , wherein said gene essential for cell survival endogenously expressed by said eukaryotic host cell includes at least one characteristic selected from the group consisting of:
a) a knock-down of said gene induces or promotes apoptosis; and b) a knock-down of said gene disturbs the cell cycle.
6 . A method for producing a product of interest, comprising culturing a eukaryotic host cell selected according to the method of claim 1 under conditions that allow for expression of the product of interest.
7 . The method according to claim 6 , comprising at least one step selected from the group consisting of:
isolating the product of interest from said cell culture medium and/or from said eukaryotic host cell; and processing the isolated product of interest.
8 . A method for performing an RNAi experiment, comprising the following steps:
a) introducing an expression vector into a eukaryotic host cell, wherein said eukaryotic host cell endogenously expresses a gene essential for cell survival, wherein said expression vector comprises at least
i) a recombinant polynucleotide encoding a restoration product that is capable of restoring and/or maintaining cell viability when the gene essential for cell survival endogenously expressed by said eukaryotic host cell is targeted and down-regulated by an RNAi inducing compound used for selection; and
ii) a recombinant polynucleotide encoding a product of a target gene of interest expressed by said eukaryotic host cell;
b) introducing into said eukaryotic host cell an RNAi inducing compound that targets expression of said target gene of interest expressed by said eukaryotic host cell; and c) culturing the eukaryotic host cells into which said expression vector has been introduced under selective conditions; wherein the selective conditions comprise at least the introduction of at least one RNAi inducing compound that targets at least the gene essential for cell survival that is endogenously expressed by said eukaryotic host cell, wherein said RNAi inducing compound that targets at least the gene essential for cell survival that is endogenously expressed by said eukaryotic host cell is selected from the group consisting of (i) short interfering nucleic acids (siNA), (ii) short interfering RNAs (sRNA), (iii) microRNAs (miRNA), (iv) short hairpin RNAs (shRNA), and (v) precursors of (i)-(iv) that are processed in the cell into said RNAi inducing compound, wherein the at least one gene essential for cell survival endogenously expressed by said population of eukaryotic host cells comprises ubiquitin, and wherein said at least one RNAi inducing compound targets a sequence located in a 3′ untranslated region of a transcript of said at least one gene essential for cell survival that is endogenously expressed by said eukaryotic host cells, wherein the sequence of said at least one gene essential for cell survival endogenously expressed by said eukaryotic host cells that is targeted by said at least one RNAi inducing compound is selected from the group consisting of:
TAAAGGTTTCGTTGCATGGTA;
(SEQ ID NO: 1)
TCAGTAATAGCTGAACCTGTT;
(SEQ ID NO: 2)
GTGCCCAGTGATGGCATTACT;
(SEQ ID NO: 3)
AAGTTTAGAAATTACAAGTTT;
(SEQ ID NO: 4)
TTCAGTCATGGCATTCGCAGT;
(SEQ ID NO: 5)
TACTCTGCACTATAGCCATTT;
(SEQ ID NO: 6)
TTCAGTAATAGCTGAACCTGT;
(SEQ ID NO: 7)
TAATAGCTGAACCTGTTCAAA;
(SEQ ID NO: 8)
AAATGTTAATAAAGGTTTCGT;
(SEQ ID NO: 9)
GTTAATAAAGGTTTCGTTGCA;
(SEQ ID NO: 10)
TTAATAAAGGTTTCGTTGCAT;
(SEQ ID NO: 11)
and
GTAATAGCTGAACCTGTTCAA;
(SEQ ID NO: 12)
and
wherein the sequence of said at least one gene essential for cell survival endogenously expressed by said eukaryotic host cells that is targeted by said at least one RNAi inducing compound is not present in the recombinant polynucleotide encoding the restoration product.
9 . The method according to claim 8 , wherein at least two of steps a, b and c are performed in parallel or sequentially.
10 . A kit comprising:
a) an expression vector to be introduced into a eukaryotic host cell which comprises
(i) an expression cassette comprising a recombinant polynucleotide encoding a restoration product that is capable of restoring and/or maintaining cell viability when a gene essential for cell survival endogenously expressed by said eukaryotic host cell is targeted and down-regulated by an RNAi inducing compound used for selection; and
(ii) a further expression cassette comprising a multiple cloning site for inserting a recombinant polynucleotide of interest; and
b) an RNAi inducing compound that targets said gene essential for cell survival that is endogenously expressed by said eukaryotic host cell; wherein said RNAi inducing compound is selected from the group consisting of (i) short interfering nucleic acids (siNA), (ii) short interfering RNAs (sRNA), (iii) microRNAs (miRNA), (iv) short hairpin RNAs (shRNA), and (v) precursors of (i)-(iv) that are processed in the cell into said RNAi inducing compound, wherein the at least one gene essential for cell survival endogenously expressed by said population of eukaryotic host cells comprises ubiquitin, and wherein said at least one RNAi inducing compound targets a sequence located in a 3′ untranslated region of a transcript of said at least one gene essential for cell survival that is endogenously expressed by said eukaryotic host cells. wherein the sequence of said at least one gene essential for cell survival endogenously expressed by said eukaryotic host cells that is targeted by said at least one RNAi inducing compound is selected from the group consisting of:
TAAAGGTTTCGTTGCATGGTA;
(SEQ ID NO: 1)
TCAGTAATAGCTGAACCTGTT;
(SEQ ID NO: 2)
GTGCCCAGTGATGGCATTACT;
(SEQ ID NO: 3)
AAGTTTAGAAATTACAAGTTT;
(SEQ ID NO: 4)
TTCAGTCATGGCATTCGCAGT;
(SEQ ID NO: 5)
TACTCTGCACTATAGCCATTT;
(SEQ ID NO: 6)
TTCAGTAATAGCTGAACCTGT;
(SEQ ID NO: 7)
TAATAGCTGAACCTGTTCAAA;
(SEQ ID NO: 8)
AAATGTTAATAAAGGTTTCGT;
(SEQ ID NO: 9)
GTTAATAAAGGTTTCGTTGCA;
(SEQ ID NO: 10)
TTAATAAAGGTTTCGTTGCAT;
(SEQ ID NO: 11)
and
GTAATAGCTGAACCTGTTCAA;
(SEQ ID NO: 12)
and
wherein the sequence of said at least one gene essential for cell survival endogenously expressed by said eukaryotic host cells that is targeted by said at least one RNAi inducing compound is not present in the recombinant polynucleotide encoding the restoration product.
11 . The kit according to claim 10 , wherein kit includes at least one characteristic selected from the group consisting of:
a) said recombinant polynucleotide encoding the product that is also encoded by said gene essential for cell survival that is endogenously expressed by said eukaryotic host cells is an RNAi selectable marker gene that provides resistance to the RNAi inducing compound, which allows for selection of eukaryotic host cells that have incorporated the expression vector under selective culture conditions; b) said expression vector comprises a further recombinant polynucleotide encoding a product which corresponds to the product of a second gene essential for cell survival that is endogenously expressed by said eukaryotic host cell; c) wherein said expression cassette comprises at least one of the following elements:
i. a promoter and/or enhancer sequence functional in said eukaryotic host cells;
ii. a transcriptional termination signal;
iii. a poly A site;
iv. an intron; or
v. a secretory leader sequence;
d) said expression vector comprises at least one origin of replication; e) said expression vector comprises at least one additional selection marker gene; and f) said recombinant polynucleotide encoding the product which corresponds to the product encoded by said gene essential for cell survival endogenously expressed by said eukaryotic host cells is resistant to the RNAi inducing compound used for selection.Join the waitlist — get patent alerts
Track US2015218552A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.