US2015093787A1PendingUtilityA1

Compositions and methods for use in recombinational cloning of nucleic acids

Assignee: LIFE TECHNOLOGIES CORPPriority: Jun 7, 1995Filed: Aug 5, 2014Published: Apr 2, 2015
Est. expiryJun 7, 2015(expired)· nominal 20-yr term from priority
C12N 15/10C12N 15/11C12N 15/63C12N 2800/70
66
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention relates generally to compositions and methods for use in recombinational cloning of nucleic acid molecules. In particular, the invention relates to nucleic acid molecules encoding one or more recombination sites or portions thereof, to nucleic acid molecules comprising one or more of these recombination site nucleotide sequences and optionally comprising one or more additional physical or functional nucleotide sequences. The invention also relates to vectors comprising the nucleic acid molecules of the invention, to host cells comprising the vectors or nucleic acid molecules of the invention, to methods of producing polypeptides using the nucleic acid molecules of the invention, and to polypeptides encoded by these nucleic acid molecules or produced by the methods of the invention. The invention also relates to antibodies that bind to one or more polypeptides of the invention or epitopes thereof. The invention also relates to the use of these compositions in methods for recombinational cloning of nucleic acids, in vitro and in vivo, to provide chimeric DNA molecules that have particular characteristics and/or DNA segments.

Claims

exact text as granted — not AI-modified
1 . An isolated nucleic acid molecule comprising a nucleotide sequence selected from the group of nucleotide sequences consisting of an attB1 nucleotide sequence as set forth in  FIG. 9 , an attB2 nucleotide sequence as set forth in  FIG. 9 , an attP1 nucleotide sequence as set forth in  FIG. 9 , an attP2 nucleotide sequence as set forth in  FIG. 9 , an attL1 nucleotide sequence as set forth in  FIG. 9 , an attL2 nucleotide sequence as set forth in  FIG. 9 , an attR1 nucleotide sequence as set forth in  FIG. 9 , an attR2 nucleotide sequence as set forth in  FIG. 9 , a polynucleotide complementary thereto, and a mutant, fragment, or derivative thereof. 
     
     
         2 - 9 . (canceled) 
     
     
         10 . The isolated nucleic acid molecule of  claim 1 , further comprising one or more functional or structural nucleotide sequences selected from the group consisting of one or more multiple cloning sites, one or more localization signals, one or more transcription termination sites, one or more transcriptional regulatory sequences, one or more translational signals, one or more origins of replication, one or more fusion partner peptide-encoding nucleic acid molecules, one or more protease cleavage sites, and one or more 5′ polynucleotide extensions. 
     
     
         11 . The nucleic acid molecule of  claim 10 , wherein said transcriptional regulatory sequence is a promoter, an enhancer, or a repressor. 
     
     
         12 . The nucleic acid molecule of  claim 10 , wherein said fusion partner peptide-encoding nucleic acid molecule encodes glutathione S-transferase (GST), hexahistidine (HiS 6 ) or thioredoxin (Trx). 
     
     
         13 . The nucleic acid molecule of  claim 10 , wherein said 5′ polynucleotide extension consists of from one to five nucleotide bases. 
     
     
         14 . The nucleic acid molecule of  claim 13 , wherein said 5′ polynucleotide extension consists of four or five guanine nucleotide bases. 
     
     
         15 . A primer nucleic acid molecule suitable for amplifying a target nucleotide sequence, comprising the isolated nucleic acid molecule of claim for a portion thereof linked to a target-specific nucleotide sequence useful in amplifying said target nucleotide sequence. 
     
     
         16 . The primer nucleic acid molecule of  claim 15 , wherein said primer comprises an attB1 nucleotide sequence having the sequence shown in  FIG. 9  or a portion thereof, or a polynucleotide complementary to the sequence shown in  FIG. 9  or a portion thereof. 
     
     
         17 . The primer nucleic acid molecule of  claim 15 , wherein said primer comprises an attB2 nucleotide sequence having the sequence shown in  FIG. 9  or a portion thereof, or a polynucleotide complementary to the sequence shown in  FIG. 9  or a portion thereof. 
     
     
         18 . The primer nucleic acid molecule of  claim 15 , further comprising a 5′ terminal extension of four or five guanine bases. 
     
     
         19 . A vector comprising the isolated nucleic acid molecule of  claim 1 . 
     
     
         20 . The vector of  claim 19 , wherein said vector is an Expression Vector. 
     
     
         21 . (canceled) 
     
     
         22 . A method of synthesizing or amplifying one or more nucleic acid molecules comprising:
 (a) mixing one or more nucleic acid templates with at least one polypeptide having polymerase or reverse transcriptase activity and at least a first primer comprising a template-specific sequence that is complementary to or capable of hybridizing to said templates and at least a second primer comprising all or a portion of a recombination site wherein said at least a portion of said second primer is homologous to or complementary to at least a portion of said first primer; and   (b) incubating said mixture under conditions sufficient to synthesize or amplify one or more nucleic acid molecules complementary to all or a portion of said templates and comprising one or more recombination sites or portions thereof at one or both termini of said molecules.   
     
     
         23 - 25 . (canceled) 
     
     
         26 . An isolated nucleic acid molecule comprising one or more att recombination sites comprising at least one mutation in its core region that increases the specificity of interaction between said recombination site and a second att recombination site. 
     
     
         27 . The isolated nucleic acid molecule of  claim 26 , wherein said mutation is at least one substitution mutation of at least one nucleotide in the seven basepair overlap region of said core region of said recombination site. 
     
     
         28 . The isolated nucleic acid molecule of  claim 26 , wherein said nucleic acid molecule comprises the sequence NNNATAC, wherein “N” refers to any nucleotide with the proviso that if one of the first three nucleotides in the consensus sequence is a TIU, then at least one of the other two of the first three nucleotides is not a TIU. 
     
     
         29 . An isolated nucleic acid molecule comprising one or more mutated att recombination sites comprising at least one mutation in its core region that enhances the efficiency of recombination between a first nucleic acid molecule comprising said mutated att recombination site and a second nucleic acid molecule comprising a second recombination site that interacts with said mutated att recombination site. 
     
     
         30 . The isolated nucleic acid molecule of  claim 29 , wherein said mutated att recombination site is a mutated attL site comprising a core region having the nucleotide sequence caacttnntnnnannaagttg (SEQID NO:92), wherein “n” represents any nucleotide. 
     
     
         31 . The isolated nucleic acid molecule of  claim 30 , wherein said mutated attL recombination site comprises a core region having a nucleotide sequence selected from agcctgctttattatactaagttggcatta (attL5; SEQ ID NO:87) and agcctgcttttttatattaagttggcatta (attL6; SEQ ID NO:88). 
     
     
         32 . The isolated nucleic acid molecule of  claim 29 , wherein said mutated att recombination site comprises a core region having a nucleotide sequence selected from the group consisting of ggggacaactttgtacaaaaaagttggct (attB1.6; SEQ ID NO:105), ggggacaactttgtacaagaaagctgggt (attB2.2; SEQ ID NO:97), and ggggacaactttgtacaagaaagttgggt (attB2.10; SEQ ID NO: 107). 
     
     
         33 - 38 . (canceled)

Join the waitlist — get patent alerts

Track US2015093787A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.