METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA

Abstract

The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method.

We claim: 
     
         1 . A method for inducing and/or promoting the skipping of exon 45 of the human dystrophin pre-mRNA, said method comprising:
 providing an oligonucleotide of 21 to 50 nucleotides in length to a cell, wherein said oligonucleotide comprises a nucleotide sequence which is complementary to a target sequence of exon 45 of the human dystrophin pre-mRNA, wherein said target sequence comprises a nucleotide sequence that is complementary to the sequence UUUGCCGCUGCCCAAUGCCAUCCUG (SEQ ID NO: 3) and wherein said oligonucleotide induces skipping of said exon in the cell.   
     
     
         2 . A method for treating Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) in a patient by inducing the skipping of exon 45 of the human dystrophin pre-mRNA, said method comprising:
 providing an oligonucleotide of 21 to 50 nucleotides in length to a cell, wherein said oligonucleotide comprises a nucleotide sequence which is complementary to a target sequence of exon 45 of the human dystrophin pre-mRNA, wherein said target sequence comprises a nucleotide sequence that is complementary to the sequence UUUGCCGCUGCCCAAUGCCAUCCUG (SEQ ID NO: 3) and wherein said oligonucleotide induces skipping of said exon in the cell.   
     
     
         3 . The method of  claim 1 , wherein the cell is a muscle cell. 
     
     
         4 . The method of  claim 1 , wherein the cell is from a subject with Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD). 
     
     
         5 . The method of  claim 1 , wherein mRNA produced from skipping of exon 45 of the dystrophin pre-mRNA encodes a functional dystrophin protein or a dystrophin protein of a Becker patient. 
     
     
         6 . The method of  claim 1 , wherein the oligonucleotide comprises DNA. 
     
     
         7 . The method of  claim 1 , wherein the oligonucleotide comprises RNA. 
     
     
         8 . The method of  claim 1 , wherein the nucleotides of the oligonucleotide comprise purine and pyrimidine bases. 
     
     
         9 . The method of  claim 8 , wherein the bases are selected from the group consisting of adenine, cytosine, guanine, thymine, and uracil. 
     
     
         10 . The method of  claim 1 , wherein the oligonucleotide sequence comprises a modified base, and/or a modified sugar moiety, and/or a non-natural internucleoside linkage. 
     
     
         11 . The method of  claim 10 , wherein the oligonucleotide comprises a modified base. 
     
     
         12 . The method of  claim 1 , wherein the oligonucleotide has a modified backbone. 
     
     
         13 . The method of  claim 10 , wherein the oligonucleotide comprises one or more sugar moieties that are mono- or disubstituted at the 2°, 3′ and/or 5′ position. 
     
     
         14 . The method of  claim 10 , wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage. 
     
     
         15 . The method of  claim 14 , wherein each internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. 
     
     
         16 . The method of  claim 14 , wherein the oligonucleotide comprises a 2′-O-substituted phosphorothioate antisense oligonucleotide. 
     
     
         17 . The method of  claim 16 , wherein the oligonucleotide comprises a 2′-O-methyl ribose. 
     
     
         18 . The method of  claim 17 , wherein the oligonucleotide is a 2′49-methyl phosphorothioate oligonucleotide. 
     
     
         19 . The method of  claim 1 , wherein the oligonucleotide comprises a phosphorothioate antisense oligonucleotide comprising the nucleotide sequence 5′ UUUGCCGGUGCCCAAUGCCAUCCUG 3′ (SEQ ID NO: 3); and wherein the sugar moieties are each 2′-O-methyl substituted. 
     
     
         20 . The method of  claim 12 , wherein the modified backbone is selected from the group consisting of a morpholino backbone, a carbamate backbone, a siloxane backbone, a sulfide backbone, a sulfoxide backbone, a sulfone backbone, a formacetyl backbone, a thioformacetyl backbone, a methyleneformacetyl backbone, a riboacetyl backbone, an alkene containing backbone, a sulfamate backbone, a sulfonate backbone, a sulfonamide backbone, a methyleneimino backbone, a methylenehydrazino backbone and an amide backbone. 
     
     
         21 . The method of  claim 10 , wherein the oligonucleotide comprises a phosphorodiamidate internucleoside linkage. 
     
     
         22 . The method of  claim 21 , wherein each internucleoside linkage of the oligonucleotide is a phosphorodiamidate internucleoside linkage. 
     
     
         23 . The method of  claim 22 , wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide. 
     
     
         24 . The method of  claim 1 , wherein the oligonucleotide comprises a phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acid, and/or locked nucleic acid. 
     
     
         25 . The method of  claim 1 , wherein the oligonucleotide comprises a phosphorothioate internucleoside linkage, a 2′-O-methyl ribose and/or a locked nucleic acid. 
     
     
         26 . The method of  claim 1 , wherein the oligonucleotide induces exon 45 skipping in the human dystrophin pre-mRNA and dystrophin expression at the muscle cell membrane upon transfection of human muscle cells with a concentration between 0.1 nM and 1 μM of said oligonucleotide and incubation for at least 16 hours. 
     
     
         27 . The method of  claim 1 , wherein exon 45 skipping is detected by RT-PCR and/or sequence analysis. 
     
     
         28 . The method of  claim 26 , wherein dystrophin expression at the muscle cell membrane is detected by immunohistochemical and/or western blot analysis.