US2014213629A1PendingUtilityA1

Molecular targets for healing or treating wounds

Assignee: UNIV CARDIFFPriority: Mar 8, 2011Filed: Feb 17, 2012Published: Jul 31, 2014
Est. expiryMar 8, 2031(~4.6 yrs left)· nominal 20-yr term from priority
A61P 9/14A61P 43/00C12N 15/1138C12N 2330/30A61K 31/29C12N 2310/14A61P 17/02A61K 9/06C12N 2310/121A61K 31/713A61K 45/06A61K 9/0014A61K 9/0019C12N 2310/11A61K 31/555C12N 2320/30C12N 2320/31
36
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention relates to at least one molecular target for healing or treating wounds and, in particular chronic, human wounds. The molecular target is PTPRK, or a protein 50% homologous therewith, and which retains the same activity as PTPRK protein. Further, the invention concerns a novel therapeutic for treating said wounds and a novel gene therapy approach, involving said molecular target, for treating said wounds.

Claims

exact text as granted — not AI-modified
1 . A therapeutic comprising an inhibitor of one or both of PTPRK gene expression or PTPRK protein activity or an inhibitor of a protein that is at least 50% homologous to PTPRK for use in the treatment of wounds. 
     
     
         2 . The therapeutic according to  claim 1  wherein said inhibitor is an inhibitor of PTPRK gene expression. 
     
     
         3 . The therapeutic according to  claim 2  wherein said inhibitor is selected from the group consisting of: anti-sense DNA or RNA, siRNA, or ribozymes, either naked or in the form of plasmid or viral vectors. 
     
     
         4 . The therapeutic according to  claim 3  wherein said inhibitor is anti-PTPRK ribozyme/RNA transgene selected from the group comprising:
 transgene 1 5′Ctgcagagtgagttacacagcctgatgagtccgtgaggacgaaa tacaaatcctggtcagtttttgtt actagt′3 SEQ ID NO: 7; 
 transgene 2 5′Ctgcaggatgataggaccatcgccaatctgatgagtccgtgaggacgaaa tcgagttggcatttagttggatcactagt′3 SEQ ID NO: 8; and 
 transgene 3 Ctgcagtttgctcttttttacaattaatatctgatgagtccgtgaggacgaaa caactaggagaaggaggatgaactagt′3 SEQ ID NO: 9. 
 
     
     
         5 . The therapeutic according to  claim 1  wherein said inhibitor is an inhibitor of PTPRK protein function. 
     
     
         6 . The therapeutic according to  claim 5  wherein said inhibitor is selected from the group consisting of: a PTPRK binding agent that binds, either reversibly or irreversibly, to inhibit protein function such as an antibody or a known, or synthesized, PTPRK antagonist; or an agent that works upstream or downstream of the PTPRK signalling mechanism to inhibit PTPRK function. 
     
     
         7 . The therapeutic according to  claim 6  wherein said inhibitor is Stibogluconate, or a salt thereof, or Pentostam™ (GlaxoSmithKline). 
     
     
         8 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for use in treating mammalian wounds. 
     
     
         9 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for use in treating chronic wounds comprising venous ulcers, diabetic ulcers, and pressure ulcers 
     
     
         10 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for use in treating human wounds. 
     
     
         11 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for topical application. 
     
     
         12 . The therapeutic according to  claim 1  wherein the therapeutic is formulated for application to a dressing or impregnation in a dressing. 
     
     
         13 . A pharmaceutical composition comprising a therapeutic according to  claim 1  together with a pharmaceutically acceptable carrier. 
     
     
         14 . A method for preparing a pharmaceutical composition according to  claim 13  comprising bringing said therapeutic in conjunction or association with a pharmaceutically or veterinarily acceptable carrier or vehicle. 
     
     
         15 . A method for treating a mammalian wound which method comprises:
 administering to said wound a therapeutic that inhibits one or both of PTPRK gene expression or PTPRK protein activity.   
     
     
         16 . A kit for treating a wound wherein said kit comprises:
 (a) at least one therapeutic according to  claim 1 ; and   (b) at least one dressing for applying to said wound.   
     
     
         17 . A combination therapeutic for treating a wound comprising an inhibitor of PTPRK gene expression and an inhibitor of PTPRK protein activity. 
     
     
         18 . A combination therapeutic for treating a wound comprising:
 a) either an inhibitor of PTPRK gene expression or an inhibitor of PTPRK protein activity; and   b) at least one further therapeutic.   
     
     
         19 . (canceled) 
     
     
         20 . A kit for treating a wound wherein said kit comprises:
 (a) a composition according to  claim 13 ; and   (b) at least one dressing for applying to said wound.

Join the waitlist — get patent alerts

Track US2014213629A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.