US2014141421A1PendingUtilityA1

Probe, probe set, probe carrier, and testing method

Assignee: CANON KKPriority: May 14, 2007Filed: Sep 5, 2013Published: May 22, 2014
Est. expiryMay 14, 2027(~0.8 yrs left)· nominal 20-yr term from priority
C12Q 1/6895
63
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof.

Claims

exact text as granted — not AI-modified
1 - 7 . (canceled) 
     
     
         8 . A probe carrier comprising:
 a probe set for detecting a DNA of  Candida dubliniensis , comprising four probes consisting of the following base sequences (1) to (4) respectively:   (1) tgtgttttgttctggacaaacttgctttg (SEQ ID NO. 1) or the complementary sequence thereof;   (2) ctgccgccagaggacataaacttac (SEQ ID NO. 2) or the complementary sequence thereof;   (3) tagtggtataaggcggagatgcttga (SEQ ID NO. 3) or the complementary sequence thereof; and   (4) tctggcgtcgcccattttattcttc (SEQ ID NO. 4) or the complementary sequence thereof; and   a carrier on which the probe set is arranged.   
     
     
         9 . A probe carrier according to  claim 8 , wherein the four probes are the only probes on the probe carrier for detecting the DNA of  Candida dubliniensis.    
     
     
         10 . A kit for detecting a DNA of  Candida dubliniensis , comprising:
 a probe carrier according to  claim 8 ; and   a reagent for detecting a reaction of any one of the four probes with a target nucleic acid.   
     
     
         11 . A kit according to  claim 10 , wherein the reagent contains a primer set for amplifying the DNA of  Candida dubliniensis , and the primer set includes:
 an oligonucleotide having a base sequence of tccgtaggtgaacctgcgg (SEQ ID NO. 5); and   an oligonucleotide having a base sequence of tcctccgcttattgatatgc (SEQ ID NO. 6)   
     
     
         12 . A kit for detecting a DNA of  Candida dubliniensis , comprising:
 a probe set comprising four probes consisting of the following base sequences (1) to (4) respectively:   (1) tgtgttttgttctggacaaacttgctttg (SEQ ID NO. 1) or the complementary sequence thereof;   (2) ctgccgccagaggacataaacttac (SEQ ID NO. 2) or the complementary sequence thereof;   (3) tagtggtataaggcggagatgcttga (SEQ ID NO. 3) or the complementary sequence thereof; and   (4) tctggcgtcgcccattttattcttc (SEQ ID NO. 4) or the complementary sequence thereof; and   a reagent for detecting a reaction of any one of the four probes with a target nucleic acid.   
     
     
         13 . A kit according to  claim 12 , wherein the reagent contains a primer set for amplifying the DNA of  Candida dubliniensis , and the primer set includes:
 an oligonucleotide having a base sequence of tccgtaggtgaacctgcgg (SEQ ID NO. 5); and   an oligonucleotide having a base sequence of tcctccgcttattgatatgc (SEQ ID NO. 6)   
     
     
         14 . A probe set for detecting a DNA of  Candida dubliniensis  which is a pathogenic fungus, comprising four probes consisting of the following base sequences (A) to (D) respectively:
 (A) the complementary sequence of SEQ ID NO. 1;   (B) the complementary sequence of SEQ ID NO. 2;   (C) the complementary sequence of SEQ ID NO. 3; and   (D) the complementary sequence of SEQ ID NO. 4.

Join the waitlist — get patent alerts

Track US2014141421A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.