US2012301404A1PendingUtilityA1

Treatment of cachexia

Assignee: TISDALE MICHAEL JOHNPriority: Dec 11, 2006Filed: Jun 25, 2012Published: Nov 29, 2012
Est. expiryDec 11, 2026(~0.4 yrs left)· nominal 20-yr term from priority
A61P 7/00A61P 43/00A61P 35/00A61P 3/00C07K 14/705A61P 21/00
38
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention characterizes and provides a receptor for Proteolysis Inducing Factor (PIF) and associated methods and materials employing the same. These have utility, for example, in the provision of treatments for cachexia.

Claims

exact text as granted — not AI-modified
1 - 26 . (canceled) 
     
     
         27 . A method of screening a compound to test whether or not the compound has efficacy for treating cachexia, comprising:
 exposing cells or membranes comprising a receptor for Proteolysis Inducing Factor (PIF), wherein the N terminus of the mature native receptor has the amino acid sequence of SEQ ID NO: 13 to a test compound for a predetermined length of time;   (ii) detecting the activity or expression of the receptor; and   (iii) comparing the activity or expression of the receptor in the cells or membranes treated with the compound relative to activity or expression found in control cells or membranes that were not treated with the compound   
       wherein compounds with efficacy for treating cachexia decrease activity or decrease expression of the receptor relative to the controls. 
     
     
         28 . A method of screening a compound, to test whether or not the compound causes cachexia, comprising:
 (i) exposing cells or membranes comprising a receptor for Proteolysis Inducing Factor (PIF), wherein the N terminus of the mature native receptor has the amino acid sequence of SEQ ID NO: 13 to a test compound for a predetermined length of time;   (ii) detecting the activity or expression of the receptor; and   (iii) comparing the activity or expression of the receptor in the cells or membranes treated with the compound relative to activity or expression found in control cells or membranes that were not treated with the compound;   
       wherein compounds that cause cachexia increase activity or increase expression of the receptor relative to the controls. 
     
     
         29 . An in vivo method as claimed in  claim 27  or  claim 28  in which cells present in any experimental animal are exposed to the test compound. 
     
     
         30 - 35 . (canceled) 
     
     
         36 . A method for the treatment of cachexia,
 which method comprises administering to a subject in need of such treatment a therapeutically effective amount of an agent that specifically binds to the receptor for Proteolysis Inducing Factor (PIF) and decreases the biological activity of the receptor,   wherein the N terminus of the mature native receptor has the amino acid sequence of SEQ ID NO: 13,   wherein the agent is a peptide or peptide derivative.   
     
     
         37 . A method as claimed in  claim 36  wherein the agent is a peptide fragment of said receptor for PIF. 
     
     
         38 . A method as claimed in  claim 36  wherein the peptide fragment is an N terminal fragment of the receptor. 
     
     
         39 . A method as claimed in  claim 36  wherein the agent is a peptide derivative having an increased half-life in vivo compared to the receptor fragment from which it was derived. 
     
     
         40 . A method for the treatment of cachexia,
 which method comprises administering to a subject in need of such treatment a therapeutically effective amount of an agent that decreases the expression of the receptor for Proteolysis Inducing Factor (PIF),   wherein the N terminus of the mature native receptor has the amino acid sequence of SEQ ID NO: 13,   wherein the agent is selected from the list consisting of:
 (i) an antisense DNA or RNA molecule that will bind to endogenous receptor RNA transcripts such as to reduce the receptor expression; 
 (ii) a short interfering RNA (siRNA) molecule or a short hairpin RNA (shRNA) which results in the sequence-specific destruction of mRNA encoding the receptor. 
   
     
     
         41 . A method as claimed in  claim 40  wherein the agent is an antisense molecule selected from: 
       
         
           
                 
               
                   (SEQ ID NO. 12) 
                 
                   5′GGCGAAGCCGGCGGTCAGCACGGCGGCGGTCTGGTACAGGGGCTGGGG 
                 
                     
                 
                   CAGGGTGGCGCCGCCGCCGTTGATGTC . . . 3′ 
                 
                     
                 
                   (SEQ ID NO. 15) 
                 
                   5′CAGCACGTTGGGGATCAGGTACAGCTTCTGGGGCAGGGTGGCGCCGCC 
                 
                     
                 
                   GCCGTTGATGTC . . . 3′. 
                 
             
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         42 . A method as claimed in  claim 40  wherein the agent is siRNA which comprise 10-50 nucleotides, 18-30 nucleotides, 21-25 nucleotides, or 21 nucleotides. 
     
     
         43 . A method as claimed in  claim 40  wherein the agent is siRNA which comprises double stranded RNA of 21 nucleotides length, optionally with a 2-nucleotide overhang at each 3′ end. 
     
     
         44 . A method as claimed in  claim 40  wherein the agent is shRNA having sense and antisense sequences connected by a hairpin loop. 
     
     
         45 . A method for the treatment of cachexia,
 which method comprises administering to a subject in need of such treatment a therapeutically effective amount of an agent that specifically binds to the receptor for Proteolysis Inducing Factor (PIF) and blocks receptor-mediated intracellular signalling of the receptor,   wherein the N terminus of the mature native receptor has the amino acid sequence of SEQ ID NO: 13,   wherein the agent is an antibody or functional derivative of an antibody capable of binding specifically to the receptor.   
     
     
         46 . An method as claimed in  claim 45  wherein the agent is an antibody which has been raised against any one of peptides SEQ ID No. 1-10 or 13. 
     
     
         47 . An method as claimed in  claim 45  wherein the agent is a polyclonal antibody. 
     
     
         48 . An method as claimed in  claim 45  wherein the agent is a monoclonal antibody. 
     
     
         49 . An method as claimed in  claim 45  wherein the agent is a γ-immunoglobulin (IgG). 
     
     
         50 . A method as claimed in  claim 45  wherein the agent is a functional derivatives of an antibody having at least the variable domain thereof. 
     
     
         51 . A method as claimed in  claim 50  wherein the functional derivative is an antibody fragment. 
     
     
         52 . A method as claimed in  claim 51  wherein the antibody fragment is an scFV antibody. 
     
     
         53 . A method as claimed in  claim 45  wherein the agent is a humanised antibody. 
     
     
         54 . A method as claimed in  claim 38  wherein the N terminal fragment of the receptor is selected from or comprises SEQ ID NO. 1 or SEQ ID NO. 13. 
     
     
         55 . A method as claimed in  claim 39  wherein the peptide derivative is a peptoid or retropeptoid or a peptide which comprises D-amino acids.

Join the waitlist — get patent alerts

Track US2012301404A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.