US2012225034A1PendingUtilityA1

Agents useful in treating facioscapulohumeral muscular dystrophy

Assignee: BELAYEW ALEXANDRAPriority: Sep 2, 2010Filed: Sep 2, 2011Published: Sep 6, 2012
Est. expirySep 2, 2030(~4.1 yrs left)· nominal 20-yr term from priority
C12N 15/113C12N 2310/14C12N 2320/33C12N 2310/531C12N 2310/3233A61P 35/00C12N 2310/11C12N 15/111C12N 2310/315C12N 2310/3513C12N 2310/321
57
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention teaches antisense agents and RNA interference agents useful for treating diseases and conditions the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, more particularly facioscapulohumeral muscular dystrophy. Further elaborated are methods, uses and further products employing such agents.

Claims

exact text as granted — not AI-modified
1 - 36 . (canceled) 
     
     
         37 . An antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes. 
     
     
         38 . The antisense agent according to  claim 37  capable of binding to the DUX4 gene but not to the DUX4c gene. 
     
     
         39 . The antisense agent according to  claim 37  wherein the antisense agent is an antisense molecule. 
     
     
         40 . The antisense agent according to  claim 39 , wherein the antisense molecule is an antisense nucleic acid molecule, an antisense nucleic acid analogue molecule, an antisense oligonucleotide or an antisense oligonucleotide analogue. 
     
     
         41 . The antisense agent according to  claim 37 , wherein the antisense agent is between about 10 and about 100, between about 12 and about 80, between about 15 and about 50, between about 20 and about 40, or between about 20 and about 30 nucleotides or nucleotide analogues in length. 
     
     
         42 . The antisense agent according to  claim 37 , wherein the antisense agent is an antisense oligonucleotide analogue comprising a 2′-O-methylated phosphorothioate backbone or a phosphorodiamidate morpholino backbone. 
     
     
         43 . The antisense agent according to  claim 37 , wherein the antisense agent is conjugated to a cell penetrating peptide (CPP). 
     
     
         44 . The antisense agent according to  claim 37 , wherein the antisense agent is capable of binding to a sequence element required for splicing of the DUX4 or DUX4c genes. 
     
     
         45 . The antisense agent according to  claim 44 , wherein the antisense agent is capable of binding to a sequence element required for splicing of the DUX4 gene, but not required for splicing of the DUX4c gene. 
     
     
         46 . The antisense agent according to  claim 37 , wherein the sequence element required for splicing of the DUX4 or DUX4c genes is chosen from the group consisting of splice donor sites, splice acceptor sites, pyrimidine-rich or polypyrimidine tracts upstream of splice acceptor sites, exon-intron boundaries, intron-exon boundaries, branch sites and exonic splicing enhancer elements of the DUX4 or DUX4c genes. 
     
     
         47 . The antisense agent according to  claim 46 , wherein the sequence element required for splicing of the DUX4 or DUX4c genes is chosen from the group consisting of splice donor sites, splice acceptor sites, exon-intron boundaries and intron-exon boundaries of the DUX4 or DUX4c genes. 
     
     
         48 . The antisense agent according to  claim 37 , wherein the antisense agent is configured to bind to at least about 10 bases, at least about 15 bases, at least about 20 bases, at least about 25 bases, at least about 30 bases, between about 10 and about 40 bases, or between about 20 and about 30 bases of any one of the following DUX4 sequences (SEQ ID NO: 2, 4, 6, 8) or of variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences: 
       
         
           
                 
                 
               
                   (SEQ ID NO: 2) 
                     
                 
                   ggctctgctggaggagctttaggacgcggggttgggacggggtcgggtggttcggggcag; 
                     
                 
                     
                 
                   (SEQ ID NO: 4) 
                     
                 
                   gctgaccggcctgggattcctgccttctaggtctaggcccggtgagagactccacaccgc; 
                     
                 
                     
                 
                   (SEQ ID NO: 6) 
                     
                 
                   ggcatcccggggatcccagagccggcccaggtacctgcgcacgcgcgggtttgcgggcag; 
                     
                 
                   or 
                 
                     
                 
                   (SEQ ID NO: 8) 
                     
                 
                   tctgtctgtctttgcccgcttcctggctagacctgcgcgcagtgcgcaccccggctgacg. 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         49 . The antisense agent according to  claim 37 , comprising a sequence complementary to any one of the following DUX4 sequences (SEQ ID NO: 10 to 15, 66) or to variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences, or to fragments thereof comprising at least about 10 bases, at least about 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases of the respective sequences or variants of: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 10) 
                 
                     
                   cttctaggtctaggcccggtgagag; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 11) 
                 
                     
                   tggctagacctgcgcgcagtgcgca; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 12) 
                 
                     
                   cttcctggctagacctgcgcgcagt; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 13) 
                 
                     
                   agacctgcgcgcagtgcgcaccccg; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 14) 
                 
                     
                   cttcctggctagacctgcgcgcagtgcgca; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 15) 
                 
                     
                   gcccgcttcctggctagacctgcgcgcagt; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 66) 
                 
                     
                   acgcg gg   gttgggacggggtcgggt . 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         50 . The antisense agent according to  claim 37 , wherein the antisense agent is an anti-DUX4 antisense agent comprising any one of sequences (SEQ ID NO: 16 to 21, 64) or variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences, or fragments thereof comprising at least about 10 bases, at least about 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases, of the respective sequences or variants: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 16) 
                 
                     
                   CUCUCACCGGGCCUAGACCUAGAAG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 17) 
                 
                     
                   UGCGCACUGCGCGCAGGUCUAGCCA; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 18) 
                 
                     
                   ACUGCGCGCAGGUCUAGCCAGGAAG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 19) 
                 
                     
                   CGGGGUGCGCACUGCGCGCAGGUCU; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 20) 
                 
                     
                   UGCGCACUGCGCGCAGGUCUAGCCAGGAAG; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 21) 
                 
                     
                   ACUGCGCGCAGGUCUAGCCAGGAAGCGGGC; 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 64) 
                 
                     
                   ACCCGACCCCGUCCCAACCCCGCGU. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         51 . The antisense agent according to  claim 37 , wherein the antisense agent is capable of binding to a sequence element required for polyadenylation of the DUX4 gene. 
     
     
         52 . The antisense agent according to  claim 51 , wherein the antisense agent is capable of binding to a sequence element required for polyadenylation of the DUX4 gene but not required for polyadenylation of the DUX4c gene. 
     
     
         53 . The antisense agent according to  claim 51 , wherein the sequence element required for polyadenylation of the DUX4 gene is a polyadenylation signal of the DUX4 gene. 
     
     
         54 . The antisense agent according to  claim 37 , wherein the antisense agent is configured to bind to at least about 10 bases, at least about 15 bases, at least about 20 bases, at least about 25 bases, at least about 30 bases, between about 10 and about 40 consecutive bases, or between about 20 and about 30 consecutive bases, of the following DUX4 sequences (SEQ ID NO: 67) or variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to said sequence: 
       
         
           
                 
                 
               
                   (SEQ ID NO: 67) 
                     
                 
                   acatctcctggatgattagttcagagatat attaaa atgccccctccctgtggatcctatagaaga. 
                     
                 
             
                
                
               
            
           
         
       
     
     
         55 . The antisense agent according to  claim 37 , wherein the antisense agent comprises a sequence complementary to the following DUX4 sequences (SEQ ID NO: 69) or to variants thereof having at least about 80%, at least about 90%, or at least about 95% sequence identity to said sequence, or to fragments thereof comprising at least 10 bases, or at least 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases of the said sequences or variants: 
       
         
           
                 
                 
                 
               
                     
                   agttcagagatat attaaa atgccc. 
                   (SEQ ID NO: 69) 
                 
             
                
               
            
           
         
       
     
     
         56 . The antisense agent according to  claim 37 , where the antisense agent is anti-DUX4 and comprises the sequence (SEQ ID NO: 65) or variants thereof having at least about 80%, at least about 90%, or at least about 95% sequence identity to said sequence, or fragments thereof comprising at least about 10 bases, at least about 12 bases, at least about 15 bases, at least about 20 bases, or at least about 25 bases of said sequence or variants: 
       
         
           
                 
                 
                 
               
                     
                   GGGCAUUUUAAUAUAUCUCUGAACU. 
                   (SEQ ID NO: 65) 
                 
             
                
               
            
           
         
       
     
     
         57 . An RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins. 
     
     
         58 . The RNAi agent according to  claim 57 , wherein the RNAi agent is capable of reducing or abolishing the production of DUX4 protein but not the production of the DUX4c protein. 
     
     
         59 . The RNAi agent according to  claim 57 , wherein the RNAi agent is chosen from the group consisting of: RNAi nucleic acid molecules, RNAi nucleic acid analogue molecules, short interfering nucleic acids, short interfering nucleic acid analogues (siNA), short interfering RNA, short interfering RNA analogues (siRNA), double-stranded RNA, double-stranded RNA analogues (dsRNA), micro-RNA, micro-RNA analogues (miRNA), short hairpin RNA, and short hairpin RNA analogues (shRNA). 
     
     
         60 . The RNAi agent according to  claim 57 , wherein the RNAi agent is conjugated to a cell penetrating peptide (CPP). 
     
     
         61 . The RNAi agent according to  claim 57 , wherein the RNAi agent is configured to target any one of the following DUX4 mRNA sequences (SEQ ID NO: 44 to 46) or variants thereof having at least about 80%, at least about 90%, or at least about 95% sequence identity to the respective sequences, or fragments thereof comprising at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, between 18 and 35 bases, between 19 and 30 bases, between 20 and 25 bases, or between 21 and 23 bases of the respective sequences or variants: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 44) 
                 
                     
                   CGCGGGGAACACCUGGCUGGCUACGGAGGGGCGUG 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 45) 
                 
                     
                   GCCUUCUAGGUCUAGGCCCGGUGAGAGACUCCACA 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 46) 
                 
                     
                   UAGGCAAACCUGGAUUAGAGUUACAUCUCCUGGAU. 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         62 . The RNAi agent according to  claim 57 , wherein the RNAi agent is an anti-DUX4c RNAi agent comprising any one of the following sequences (SEQ ID NO: 47 to 49) or variants thereof having at least about 80%, at least about 90%, or at least 95% sequence identity to the respective sequences, or fragments thereof comprising at least 16 bases, at least 17 bases, or at least 18 bases of the respective sequences or variants: 
       
         
           
                 
                 
                 
               
                     
                   acaccuggcuggcuacgga; 
                   (SEQ ID NO: 47) 
                 
                     
                     
                 
                     
                   ggucuaggcccggugagag; 
                   (SEQ ID NO: 48) 
                 
                     
                     
                 
                     
                   ccuggauuagaguuacauc. 
                   (SEQ ID NO: 49) 
                 
             
                
                
                
                
                
               
            
           
         
       
     
     
         63 . The RNAi agent according  claim 57 , wherein the RNAi agent is configured to target any one of the following DUX4c mRNA sequences (SEQ ID NO: 53 to 55) or variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences, or fragments thereof comprising at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, between 18 and 35 bases, between 19 and 30 bases, between 20 and 25 bases, or between 21 and 23 bases of the respective sequences or variants: 
       
         
           
                 
                 
               
                     
                   (SEQ ID NO: 53) 
                 
                     
                   uguagacaccagaguuucagcaaaaggcacgaccu; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 54) 
                 
                     
                   cacacagaggagggcugucauucuuuccugagcau; 
                 
                     
                     
                 
                     
                   (SEQ ID NO: 55) 
                 
                     
                   uuuccccagcguucuucagucgaguuggcggagac. 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         64 . The RNAi agent according to  claim 57 , wherein the RNAi agent is an anti-DUX4c RNAi agent comprising any one of the following sequences (SEQ ID NO: 56 to 58) or variants thereof having at least about 80%, at least about 90% or at least about 95% sequence identity to the respective sequences, or fragments thereof comprising at least 16 bases, at least 17 bases or at least 18 bases of the respective sequences or variants: 
       
         
           
                 
                 
                 
               
                     
                   ccagaguuucagcaaaagg; 
                   (SEQ ID NO: 56) 
                 
                     
                     
                 
                     
                   ggagggcugucauucuuuc; 
                   (SEQ ID NO: 57) 
                 
                     
                   or 
                     
                 
                     
                     
                 
                     
                   gcguucuucagucgaguug. 
                   (SEQ ID NO: 58) 
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
         65 . A nucleic acid encoding the antisense agent defined in  claim 37 . 
     
     
         66 . A nucleic acid encoding the RNAi agent defined in  claim 57 . 
     
     
         67 . A recombinant nucleic acid construct or vector comprising a nucleic acid encoding the antisense agent defined in  claim 37 . 
     
     
         68 . A recombinant nucleic acid construct or vector comprising a nucleic acid encoding the RNAi agent defined in  claim 57 . 
     
     
         69 . A host cell comprising the construct or vector as defined in  claim 67 , or a progeny of said host cell comprising the construct or vector as defined in  claim 67 . 
     
     
         70 . A host cell comprising the construct or vector as defined in  claim 68 , or a progeny of said host cell comprising the construct or vector as defined in  claim 68 . 
     
     
         71 . A host organism comprising the host cell or progeny thereof as defined in  claim 69 , or a progeny of said host organism comprising the host cell or progeny thereof as defined in  claim 69 . 
     
     
         72 . A host organism comprising the host cell or progeny thereof as defined in  claim 70 , or a progeny of said host organism comprising the host cell or progeny thereof as defined in  claim 70 . 
     
     
         73 . A composition or formulation comprising the antisense agent defined in  claim 37 . 
     
     
         74 . A composition or formulation comprising the RNAi agent defined in  claim 57 . 
     
     
         75 . The composition or formulation of  claim 37 , wherein the composition or formulation is a pharmaceutical composition further comprising one or more pharmaceutically acceptable carriers. 
     
     
         76 . The composition or formulation of  claim 74 , wherein the composition or formulation is a pharmaceutical composition further comprising one or more pharmaceutically acceptable carriers. 
     
     
         77 . A kit of parts comprising one or more of the following parts: an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins; a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins; a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins; a host cell comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins; or a host organism comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, or a host cell comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins. 
     
     
         78 . A medicament comprising one or more of:
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins;   a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins;   a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins;   a host cell comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins; or   a host organism comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, or a host cell comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, wherein   said medicament is for use in the treatment of a disease or condition wherein the disease of condition is selected form the group consisting of a disease or condition wherein the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, the disease or condition comprises increased levels and/or increased activity of double homeobox 4 and/or double homeobox 4c, facioscapulohumeral muscular dystrophy (FSHD), the disease or condition comprises expression of a fusion protein between DUX4 or DUX4c and another, unrelated protein, a tumour, a sarcoma, a sarcoma selected from Ewing's family tumours, and paediatric undifferentiated soft tissue sarcomas and rhabdomyosarcomas.   
     
     
         79 . A method for treating a disease or condition the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c in a subject, comprising administering to said subject a therapeutically or prophylactically effective amount of one or more agents selected from the group consisting of:
 an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins;   a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes; a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins;   a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes;   a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins;   a host cell comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins; or   a host organism comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, or a host cell comprising an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins, a recombinant nucleic acid construct or vector comprising a nucleic acid encoding an antisense agent capable of binding to the double homeobox 4 (DUX4) and/or double homeobox 4c (DUX4c) genes, or a recombinant nucleic acid construct or vector comprising a nucleic acid encoding a RNA interference (RNAi) agent capable of reducing or abolishing the production of DUX4 and/or DUX4c proteins.   
     
     
         80 . The method for treating a disease or condition of  claim 43  wherein the disease of condition is selected from the group consisting of: a disease or condition comprising increased levels and/or increased activity of double homeobox 4 and/or double homeobox 4c, facioscapulohumeral muscular dystrophy (FSHD), a disease or condition comprising expression of a fusion protein between DUX4 or DUX4c and another, unrelated protein, a tumour, a sarcoma, a sarcoma selected from Ewing's family tumours, and paediatric undifferentiated soft tissue sarcomas and rhabdomyosarcomas.

Join the waitlist — get patent alerts

Track US2012225034A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.