Rapid display method in translational synthesis of peptide

Abstract

Provided are linkers suitable for preparing a conjugate of a nucleic acid and a peptide as a translation product thereof in a reconstituted cell-free translation system in genotype-phenotype mapping (display methods), said linkers comprising a single-stranded structure region having a side chain base pairing with the base at the 3′-end of an mRNA at one end and a peptidyl acceptor region containing an amino acid attached to an oligo RNA consisting of a nucleotide sequence of ACCA via an ester bond at the other end, characterized in that the ester bond is formed by using an artificial RNA catalyst. Also provided are display methods using [mRNA]-[linker]-[peptide] conjugates assembled via such linkers.

1 . A linker used for preparing a conjugate in which an mRNA and a peptide as a translation product thereof are coupled via the linker in a reconstituted in vitro protein synthesis system, said linker comprising:
 a single-stranded structure region having side chain bases pairing with the bases at the 3′-end of the mRNA at one end of the linker, and   a peptidyl acceptor region having a group capable of binding to the translation product by peptidyl transfer reaction at the other end of the linker,   wherein the peptidyl acceptor region has a structure containing an amino acid attached to an oligo RNA consisting of a nucleotide sequence of ACCA via an ester bond; and   said ester bond is formed by an aminoacylation reaction using an artificial RNA catalyst.   
     
     
         2 . The linker of  claim 1  wherein the single-stranded structure region and the peptidyl acceptor region are connected via a polyethylene glycol moiety. 
     
     
         3 . The linker of  claim 1  or  2  wherein the single-stranded structure region consists of a single-stranded DNA. 
     
     
         4 . The linker of  claim 1  wherein the artificial RNA catalyst used in the aminoacylation reaction has a chemical structure consisting of any one of the RNA sequences below: 
       
         
           
                 
               
                   (SEQ ID NO: 3) 
                 
                   GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU 
                 
                     
                 
                   (SEQ ID NO: 4) 
                 
                   GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU 
                 
                     
                 
                   (SEQ ID NO: 5) 
                 
                   GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU 
                 
                     
                 
                   (SEQ ID NO: 19) 
                 
                   GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGGU. 
                 
             
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         5 . A process for preparing an [mRNA]-[linker]-[peptide] conjugate in which an mRNA and a peptide as a translation product thereof are coupled via the linker of  claim 1 , comprising the steps of:
 preparing the linker of  claim 1 ,   synthesizing an mRNA having a sequence capable of hybridizing with the base sequence of the single-stranded structure region of the linker downstream of a sequence encoding a peptide; and   contacting the linker with the mRNA and translating the mRNA into the peptide in a reconstituted in vitro protein synthesis reaction solution.   
     
     
         6 . A process for preparing an [mRNA]-[linker]-[peptide] conjugate in which an mRNA and a peptide as a translation product thereof are coupled via the linker of  claim 1 , comprising the steps of:
 preparing the linker of  claim 1 ,   synthesizing a template DNA for an mRNA having a sequence capable of hybridizing with the base sequence of the single-stranded structure region of the linker downstream of a sequence encoding a peptide, and   introducing the linker and the DNA into a reconstituted in vitro protein synthesis reaction solution, thereby performing transcription from the DNA into the mRNA and translation into the peptide as well as complex formation between the linker and the mRNA.   
     
     
         7 . The process of  claim 5  or  6  wherein the reconstituted in vitro protein synthesis reaction solution contains a tRNA charged with a non-proteinogenic amino acid or hydroxy acid, whereby the translated peptide constitutes a unusual peptide. 
     
     
         8 . A library comprising [mRNA]-[linker]-[unusual peptide] conjugates prepared by the process of  claim 7 . 
     
     
         9 . A method for selecting a peptide aptamer that binds to a target substance from a library of [mRNA]-[linker]-[peptide] conjugates in which each mRNA and a peptide as a translation product thereof are coupled via the linker of  claim 1 , said method comprising the steps of:
 preparing the linker of  claim 1 ;   preparing an mRNA library comprising mRNAs each having a sequence capable of hybridizing with the base sequence of the single-stranded structure region of the linker downstream of a sequence encoding a random peptide sequence;   contacting the linker with the mRNA library and performing translation into the peptide in a reconstituted in vitro protein synthesis reaction solution, thereby preparing an [mRNA]-[linker]-[peptide] conjugate library;   contacting the target substance with the [mRNA]-[linker]-[peptide] conjugate library; and   selecting a conjugate presenting the peptide bound to the target substance.   
     
     
         10 . The method of  claim 9  wherein the target substance has been biotinylated. 
     
     
         11 . The method of  claim 9  or  10  wherein the reconstituted in vitro protein synthesis reaction solution contains a tRNA charged with a non-proteinogenic amino acid or hydroxy acid, whereby the translated peptide constitutes a unusual peptide. 
     
     
         12 . A process for preparing the linker of  claim 2 , comprising the steps of:
 synthesizing a chimeric oligonucleotide consisting of the single-stranded structure region and an oligo RNA of a sequence of ACCA connected via a polyethylene glycol moiety; and   attaching an amino acid to adenosine at the 3′ end of the chimeric oligonucleotide via an ester bond by a reaction using an artificial RNA catalyst,   thereby preparing a linker consisting of the single-stranded structure region and the peptidyl acceptor region connected via the polyethylene glycol moiety.   
     
     
         13 . The method of  claim 12  wherein the artificial RNA catalyst has a chemical structure consisting of any one of the RNA sequences below: 
       
         
           
                 
               
                   (SEQ ID NO: 3) 
                 
                   GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU 
                 
                     
                 
                   (SEQ ID NO: 4) 
                 
                   GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU 
                 
                     
                 
                   (SEQ ID NO: 5) 
                 
                   GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGGU 
                 
                     
                 
                   (SEQ ID NO: 19) 
                 
                   GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGGU.