US2012107812A1PendingUtilityA1

Means and methods for investigating nucleic acid sequences

Assignee: KUIJPERS TACO WILLEMPriority: Nov 5, 2008Filed: Oct 5, 2011Published: May 3, 2012
Est. expiryNov 5, 2028(~2.3 yrs left)· nominal 20-yr term from priority
C12Q 1/6858C12Q 1/6883C12Q 2600/156C12Q 1/6876C07H 21/04
50
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention provides improved methods for investigating nucleic acid sequences, wherein at least one additional probe is used which is specific for a (pseudo)gene variant of a target nucleic acid. The invention further provides improved calibrators which are particularly suitable for determining (pseudo)gene variants and copy number variation.

Claims

exact text as granted — not AI-modified
1 . A nucleic acid molecule comprising a sequence which has at least 70% sequence identity with at least one nucleic acid sequence consisting of:
 a) a probe set of  FIGS. 3A ,  3 B,  3 C,  3 D,  3 F and/or  3 G, without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC of said probe sets, or   b) a complementary sequence of said probe set without said primer binding sites, wherein said nucleic acid sequence of a) or b) either comprises immediately adjacent to each other:   the sequences or complementary sequences of a left probe of said probe set, without primer binding site GGGTTCCCTAAGGGTTGGA, and of a right probe of the same probe set, without primer binding site TCTAGATTGGATCTTGCTGGCAC or TCTAGATTGGATCTTGCTGGCGC, if said probe set consists of two probes; or   the sequences or complementary sequences of a left probe of said probe set, without primer binding site GGGTTCCCTAAGGGTTGGA, and of a middle probe, and right probe of the same probe set, without primer binding site TCTAGATTGGATCTTGCTGGCAC or TCTAGATTGGATCTTGCTGGCGC, if said probe set consists of three probes.   
     
     
         2 . A nucleic acid molecule according to  claim 1 , further comprising at least one control nucleic acid sequence. 
     
     
         3 . A nucleic acid molecule according to  claim 1 , comprising at least five nucleic acid sequences as defined in  claim 1 . 
     
     
         4 . A nucleic acid molecule according to  claim 1 , comprising sequences selected from the group consisting of:
 all nucleic acid sequences of  FIG. 3A  without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC, or sequences having at least 70% sequence identity to said nucleic acid sequences, and   all nucleic acid sequences of  FIG. 3B  without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC, or sequences having at least 70% sequence identity to said nucleic acid sequences, and   all nucleic acid sequences of  FIG. 3C  without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC, or sequences having at least 70% sequence identity to said nucleic acid sequences, and   all nucleic acid sequences of  FIG. 3D  without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC, or sequences having at least 70% sequence identity to said nucleic acid sequences, and   all nucleic acid sequences of  FIG. 3F  without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC, or sequences having at least 70% sequence identity to said nucleic acid sequences, and   all nucleic acid sequences of  FIG. 3G  without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC, or sequences having at least 70% sequence identity to said nucleic acid sequences, and   any combination thereof, and   any complementary sequences thereof.   
     
     
         5 . A nucleic acid molecule according to  claim 1 , comprising at least two, preferably at least five, control nucleic acid sequences. 
     
     
         6 . A nucleic acid molecule according to  claim 2 , wherein said control nucleic acid sequence comprises a sequence of at least 10 nucleotides, preferably at least 20 nucleotides, which has at least 70% sequence identity with a sequence of a gene which has a constant copy number in the human genome. 
     
     
         7 . A nucleic acid molecule according to  claim 2 , wherein said at least one control nucleic acid sequence comprises a sequence of at least 10 nucleotides, preferably at least 20 nucleotides, which has at least 70% sequence identity with a sequence of a gene encoding a protein selected from the group consisting of FGF3, BCAS4, LMNA, GALT, SPG4, IL-4 and NF2, or any combination thereof, or with a complementary sequence thereof. 
     
     
         8 . A nucleic acid molecule according to  claim 2 , wherein said at least one control nucleic acid comprises a sequence of at least 10 nucleotides, preferably at least 20 nucleotides, which has at least 70% sequence identity with at least one nucleic acid sequence consisting of:
 a) a probe set of  FIGS. 3E  and/or  3 H, without the primer binding sites GGGTTCCCTAAGGGTTGGA and TCTAGATTGGATCTTGCTGGCAC and TCTAGATTGGATCTTGCTGGCGC of said probe sets, or   b) a complementary sequence of said probe set without said primer binding sites, wherein said nucleic acid sequence of a) or b) either comprises immediately adjacent to each other:   the sequences or complementary sequences of a left probe of said probe set, without primer binding site GGGTTCCCTAAGGGTTGGA, and of a right probe of the same probe set, without primer binding site TCTAGATTGGATCTTGCTGGCAC or TCTAGATTGGATCTTGCTGGCGC, if said probe set consists of two probes; or   the sequences or complementary sequences of a left probe of said probe set, without primer binding site GGGTTCCCTAAGGGTTGGA, and of a middle probe and of a right probe of the same probe set, without primer binding site TCTAGATTGGATCTTGCTGGCAC or TCTAGATTGGATCTTGCTGGCGC, if said probe set consists of three probes.   
     
     
         9 . A nucleic acid molecule according to  claim 1 , wherein at least one of said nucleic acid sequences or complementary sequences thereof and/or at least one of said control nucleic acid sequences or complementary sequences thereof are followed from 5′ to 3′ by a non-coding sequence of at least 5, preferably at least 20 nucleotides. 
     
     
         10 . A nucleic acid molecule comprising a sequence which has at least 70% sequence identity with a sequence as depicted in  FIG. 19 . 
     
     
         11 . A vehicle or plasmid comprising at least one nucleic acid molecule according to  claim 1 . 
     
     
         12 . A method for determining the copy number of at least one KIR gene of an individual comprising:
 amplifying a sequence with a length of at least 10 nucleotides of said at least one KIR gene using a sample of said individual and amplifying a sequence with a length of at least 10 nucleotides of said at least one KIR gene using a reference sample, said reference sample comprising a nucleic acid molecule according to  claim 1  or a plasmid; and   amplifying a sequence with a length of at least 10 nucleotides of at least one control gene using said sample of said individual and amplifying a sequence with a length of at least 10 nucleotides of said at least one control gene using said reference sample;   determining a level of amplified product of said sequence of said at least one KIR gene from said sample of said individual and determining a level of amplified product of said sequence of said at least one KIR gene from said reference sample; and   determining a level of amplified product of said sequence of said at least one control gene from said sample of said individual and determining a level of amplified product of said sequence of said at least one control gene in said reference sample; and   comparing said levels of amplified products of said sequences of said at least one KIR gene with each other and with said levels of amplified products of said sequences of said at least one control gene, thereby determining the copy number of said at least one KIR gene.   
     
     
         13 . A method according to  claim 12 , further comprising the steps of:
 a) adding to said sample of said individual and to said reference sample at least one probe set selected from  FIGS. 3A ,  3 B,  3 C,  3 D,  3 F and/or  3 G, and   b) optionally, adding to said sample of said individual and to said reference sample at least one probe set selected from  FIG. 3E  or  3 H, and   c) allowing hybridization of said probe set or probe sets to complementary nucleic acid of said sample of said individual, and   d) allowing hybridization of said probe set or probe sets to complementary nucleic acid of said reference sample, and   e) subjecting nucleic acid of said sample of said individual, and nucleic acid of said reference sample to a ligation reaction.   
     
     
         14 . A method according to  claim 13 , further comprising amplifying ligated nucleic acid and determining levels of amplified products, thereby determining the copy number of at least one KIR gene of said individual. 
     
     
         15 . A method according to  claim 12 , wherein at least one of said probe sets selected from  FIGS. 3A ,  3 B,  3 C,  3 D,  3 F and/or  3 G comprises a third nucleic acid probe. 
     
     
         16 . A method for determining a KIR haplotype of an individual comprising determining the copy number of at least 5, preferably at least 10, more preferably at least 15, most preferably all KIR genes of said individual with a method according to  claim 12 .

Join the waitlist — get patent alerts

Track US2012107812A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.