New competence stimulating peptide

Abstract

The present invention concerns a new competence stimulating peptide identified in Firmicutes, in particular Streptococcus , and more preferably S. thermophilus and methods of producing transformation competent Firmicutes, in particular Streptococcus , and more preferably S. thermophilus bacteria.

1 - 17 . (canceled) 
     
     
         18 . An isolated polypeptide comprising the amino acid sequence of SEQ ID No. 7 (IAILPYFAGCL), a derivative thereof having a percentage of identity of at least 70% with the amino acid sequence SEQ ID No. 7; or a fragment of SEQ ID No. 7, wherein said derivative or fragment is capable of stimulating competence in  Streptococcus.    
     
     
         19 . The isolated polypeptide of  claim 18  wherein the derivative thereof has a percentage of identity of at least 95% with the amino acid sequence of SEQ ID No. 7. 
     
     
         20 . The isolated polypeptide of  claim 18  wherein said polypeptide consists of the amino acid sequence of SEQ ID No. 7 or consists of a derivative thereof having a percentage of identity of at least 70% with the amino acid sequence of SEQ ID No. 7. 
     
     
         21 . The isolated polypeptide of  claim 22  wherein the derivative thereof has a percentage of identity of at least 95% with the amino acid sequence of SEQ ID No. 7. 
     
     
         22 . The isolated polypeptide of  claim 18  wherein said polypeptide comprises the amino acid sequence of SEQ ID No. 1 (LKTLKIFVLFSLLIAILPYFAGCL), a derivative thereof having a percentage of identity of at least 70% with the amino acid sequence SEQ ID No. 1; or a fragment of SEQ ID No. 1, wherein said derivative or fragment is capable of stimulating competence in  Streptococcus.    
     
     
         23 . The isolated polypeptide of  claim 22  wherein the derivative thereof has a percentage of identity of at least 95% with the amino acid sequence of SEQ ID No 1. 
     
     
         24 . The isolated polypeptide of  claim 18 , wherein the length of said isolated polypeptide is less than 100 amino acids. 
     
     
         25 . The isolated polypeptide of  claim 18 , further comprising an amino acid sequence corresponding to a signal peptide. 
     
     
         26 . An isolated nucleic acid encoding the isolated polypeptide as defined in  claim 18 . 
     
     
         27 . A vector comprising the nucleic acid as defined in  claim 26  operably linked to a gene expression sequence. 
     
     
         28 . A host cell genetically engineered with the vector as defined in  claim 27 . 
     
     
         29 . A culture medium comprising an effective amount of the isolated polypeptide of  claim 18  and nutrients for growth of a bacterium of the phylum Firmicutes. 
     
     
         30 . The culture medium of  claim 29 , wherein said effective amount is between 0.1 ng/ml and 1 mg/ml. 
     
     
         31 . The culture medium of  claim 29  wherein the bacterium is of the genus  Streptococcus.    
     
     
         32 . The culture medium of  claim 29  wherein the bacterium is of the species  Streptococcus thermophilus.    
     
     
         33 . A method of producing transformation competent bacteria of the phylum Firmicutes comprising the step of contacting said bacteria with an effective amount of the polypeptide of  claim 18 . 
     
     
         34 . The method of  claim 33  wherein the bacteria are of the genus  Streptococcus.    
     
     
         35 . A method of  claim 34  wherein said contacting step comprises the steps of (i) culturing said bacteria in a peptide-free medium to an OD 600  between 1.5 and 2.5 and (ii) diluting the culture of step (i) to an OD 600  between 0.01 and 0.1, wherein said bacteria produce said polypeptide during step (i). 
     
     
         36 . The method of  claim 35  wherein the bacteria are of the species  Streptococcus thermophilus.    
     
     
         37 . The method of  claim 33  wherein said method is performed in a culture medium comprising an effective amount of said polypeptide. 
     
     
         38 . A method for producing a mutant bacterium of the phylum Firmicutes which comprises the steps of:
 (a) producing transformation competent bacteria of the phylum Firmicutes by the method of  claim 33 ; and   (b) contacting said transformation competent bacteria with homologous DNA under conditions to allow transformation of said bacteria with said homologous DNA.   
     
     
         39 . The method of  claim 38  further comprises the steps of selecting and/or amplifying the mutant bacteria thus generated. 
     
     
         40 . A method for identifying a compound stimulating competence in a bacterium of the genus  Streptococcus  comprising the steps of:
 i) contacting, with said compound, a host cell transformed with a nucleic acid comprising a nucleic acid sequence coding for a reporter protein under the control of all or part of a promoter preceded by the inverted repeat sequence recognized by the PlcR-like regulator:   
       
         
           
                 
                 
               
                     
                   (SEQ ID N o  3) 
                 
                     
                   ATAGTGACATATATGTCTCTAT 
                 
                     
                   or 
                 
                     
                     
                 
                     
                   (SEQ ID N o  4) 
                 
                     
                   GTGGTGACATAAATGTCACTAT; 
                 
                     
                   and 
                 
             
                
                
                
                
                
                
                
               
            
           
         
         ii) selecting the compound that stimulates the expression of said reporter protein. 
       
     
     
         41 . The method of  claim 40  wherein the host cell is a bacterial cell. 
     
     
         42 . The method of  claim 40  wherein the reporter protein is GFP or beta-galactosidase.