US2011177971A1PendingUtilityA1

Method for diagnosing the stage of a thyroid tumor

Individually held — no corporate assignee on recordPriority: Apr 9, 2004Filed: Feb 10, 2011Published: Jul 21, 2011
Est. expiryApr 9, 2024(expired)· nominal 20-yr term from priority
G01N 33/57557C12Q 2600/158G01N 33/5011C12Q 2600/136C12Q 1/6886C12Q 2600/112C12Q 1/6883C12Q 1/6837
45
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The present invention relates to the use of genes differentially expressed in benign thyroid lesions and malignant thyroid lesions for the diagnosis and staging of thyroid cancer.

Claims

exact text as granted — not AI-modified
1 . A method of identifying the stage of a thyroid tumor in a subject comprising:
 a) measuring the expression of one or more nucleic acid sequences selected from the group consisting of differentially expressed thyroid (DET) gene C21 or f4, Hs.145049, Hs.296031, KIT, LSM7, and SYNGR2 in a test cell population obtained from the thyroid tumor in the subject, wherein at least one cell in said test cell population is capable of expressing one or more nucleic acid sequences selected from the group consisting of DET gene C21 or f4, Hs.145049, Hs.296031, KIT, LSM7, and SYNGR2;   b) comparing the expression of the nucleic acid sequence(s) to the expression of the nucleic acid sequence(s) in a reference cell population comprising at least one cell for which a thyroid tumor stage is known; and   c) identifying a difference, if present, in expression levels of one or more nucleic acid sequences selected from the group consisting of DET gene C21 or f4, Hs.145049, Hs.296031, KIT, LSM7, and SYNGR2, in the test cell population and reference cell population, thereby identifying the stage of the thyroid tumor in the subject.   
     
     
         2 . The method of  claim 1 , wherein a difference in the expression of the nucleic acid(s) in the test cell population as compared to the reference cell population indicates that the test cell population has a different stage than the cells from the reference cell population. 
     
     
         3 . The method of  claim 1 , wherein a similar expression pattern of the nucleic acid(s) in the test cell population as compared to the reference cell population indicates that the test cell population has the same thyroid tumor stage as the cells from the reference cell population. 
     
     
         4 . The method of  claim 1 , wherein the reference cell population is a plurality of cells or a database. 
     
     
         5 . The method of  claim 1 , wherein the subject is a human. 
     
     
         6 . The method of  claim 1 , wherein the tumor or thyroid lesion is selected from the group consisting of: papillary thyroid carcinoma, follicular variant of papillary thyroid carcinoma, follicular carcinoma, Hurthle cell tumor, anaplastic thyroid cancer, medullary thyroid cancer, thyroid lymphoma, poorly differentiated thyroid cancer and thyroid angiosarcoma. 
     
     
         7 . The method of  claim 1 , wherein expression of the nucleic acid(s) is measured by microarray. 
     
     
         8 . The method of  claim 1 , wherein expression of the nucleic acid(s) is measured by probing the nucleic acid(s). 
     
     
         9 . The method of  claim 1 , wherein expression of the nucleic acids(s) is measured by amplifying the nucleic acid(s). 
     
     
         10 . The method of  claim 1 , wherein the expression of the nucleic acid(s) is measured by amplifying the nucleic acid(s) and detecting the amplified nucleic acid with a fluorescent probe. 
     
     
         11 . The method of  claim 10 , wherein C21 or f4 nucleic acid is amplified utilizing forward primer GCAATCCTCTTACCTCCGCTTT (SEQ ID NO: 7) and reverse primer GGAATCGGAGACAGAAGAGAGCTT (SEQ ID NO: 8) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CTGGGACCACAGATGTATCCTCCACTCC (SEQ ID NO: 9) linked to a fluorescent label. 
     
     
         12 . The method of  claim 10 , wherein Hs.145049 nucleic acid is amplified utilizing forward primer GGCTGACTGGCAAAAAGTCTTG (SEQ ID NO: 1) and reverse primer TTGGTTCCCTTAAGTTCTCAGAGTTT (SEQ ID NO: 2) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TGGCCCTGTCACTCCCATGATGC (SEQ ID NO: 3) linked to a fluorescent label. 
     
     
         13 . The method of  claim 10 , wherein Hs.296031 nucleic acid is amplified utilizing forward primer TGCCAAGGAGCTTTGTTTATAGAA (SEQ ID NO: 19) and reverse primer ATGACGGCATGTACCAACCA (SEQ ID NO: 20) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TTGGTCCCCTCAGTTCTATGCTGTTGTGT (SEQ ID NO: 21) linked to a fluorescent label. 
     
     
         14 . The method of  claim 10 , wherein KIT nucleic acid is amplified utilizing forward primer GCACCTGCTGAAATGTATGACATAAT (SEQ ID NO: 22) and reverse primer TTTGCTAAGTTGGAGTAAATATGATTGG (SEQ ID NO: 23) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGC (SEQ ID NO: 24) linked to a fluorescent label. 
     
     
         15 . The method of  claim 10 , wherein LSM7 nucleic acid is amplified utilizing forward primer GACGATCCGGGTAAAGTTCCA (SEQ ID NO: 34) and reverse primer AGGTTGAGGAGTGGGTCGAA (SEQ ID NO: 35) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence AGGCCGCGAAGCCAGTGGAATC (SEQ ID NO: 36) linked to a fluorescent label. 
     
     
         16 . The method of  claim 10 , wherein SYNGR2 nucleic acid is amplified utilizing forward primer GCTGGTGCTCATGGCACTT (SEQ ID NO: 31) and reverse primer CCCTCCCCAGGCTTCCTAA (SEQ ID NO: 32) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence AAGGGCTTTGCCTGACAACACCCA (SEQ ID NO: 33) linked to a fluorescent label. 
     
     
         17 . The method of  claim 1 , wherein expression of the nucleic acid(s) is measured by detecting the protein expression product of the nucleic acid(s). 
     
     
         18 . A method of identifying the stage of a thyroid tumor in a subject comprising:
 a) measuring the expression of one or more nucleic acid sequences selected from the group consisting of differentially expressed thyroid (DET) gene C21 or f4, Hs.145049, Hs.296031, KIT, SYNGR2, C11 or f8, CDH1, FAM13A1, IMPACT, and KIAA1128 in a test cell population obtained from the thyroid tumor in the subject, wherein at least one cell in said test cell population is capable of expressing one or more nucleic acid sequences selected from the group consisting of DET gene C21 or f4, Hs.145049, Hs.296031, KIT, SYNGR2, C11 or f8, CDH1, FAM13A1, IMPACT, and KIAA1128;   b) comparing the expression of the nucleic acid sequence(s) to the expression of the nucleic acid sequence(s) in a reference cell population comprising at least one cell for which a thyroid tumor stage is known; and   c) identifying a difference, if present, in expression levels of one or more nucleic acid sequences selected from the group consisting of DET gene C21 or f4, Hs.145049, Hs.296031, KIT, SYNGR2, C11 or f8, CDH1, FAM13A1, IMPACT, and KIAA1128, in the test cell population and reference cell population, thereby identifying the stage of the thyroid tumor in the subject.   
     
     
         19 . The method of  claim 18 , wherein a difference in the expression of the nucleic acid(s) in the test cell population as compared to the reference cell population indicates that the test cell population has a different stage than the cells from the reference cell population. 
     
     
         20 . The method of  claim 18 , wherein a similar expression pattern of the nucleic acid(s) in the test cell population as compared to the reference cell population indicates that the test cell population has the same thyroid carcinoma stage as the cells from the reference cell population. 
     
     
         21 . The method of  claim 18 , wherein the reference cell population is a plurality of cells or a database. 
     
     
         22 . The method of  claim 18 , wherein the subject is a human. 
     
     
         23 . The method of  claim 18 , wherein the thyroid tumor is selected from the group consisting of:
 papillary thyroid carcinoma, follicular variant of papillary thyroid carcinoma, follicular carcinoma, Hurthle cell tumor, anaplastic thyroid cancer, medullary thyroid cancer, thyroid lymphoma, poorly differentiated thyroid cancer and thyroid angiosarcoma.   
     
     
         24 . The method of  claim 18 , wherein expression of the nucleic acid(s) is measured by microarray. 
     
     
         25 . The method of  claim 18 , wherein expression of the nucleic acid(s) is measured by probing the nucleic acid(s). 
     
     
         26 . The method of  claim 18 , wherein expression of the nucleic acids(s) is measured by amplifying the nucleic acid(s). 
     
     
         27 . The method of  claim 18 , wherein the expression of the nucleic acid(s) is measured by amplifying the nucleic acid(s) and detecting the amplified nucleic acid with a fluorescent probe. 
     
     
         28 . The method of  claim 27 , wherein C21 or f4 nucleic acid is amplified utilizing forward primer GCAATCCTCTTACCTCCGCTTT (SEQ ID NO: 7) and reverse primer GGAATCGGAGACAGAAGAGAGCTT (SEQ ID NO: 8) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CTGGGACCACAGATGTATCCTCCACTCC (SEQ ID NO: 9) linked to a fluorescent label. 
     
     
         29 . The method of  claim 27 , wherein Hs.145049 nucleic acid is amplified utilizing forward primer GGCTGACTGGCAAAAAGTCTTG (SEQ ID NO: 1) and reverse primer TTGGTTCCCTTAAGTTCTCAGAGTTT (SEQ ID NO: 2) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TGGCCCTGTCACTCCCATGATGC (SEQ ID NO: 3) linked to a fluorescent label. 
     
     
         30 . The method of  claim 27 , wherein Hs.296031 nucleic acid can be amplified utilizing forward primer TGCCAAGGAGCTTTGTTTATAGAA (SEQ ID NO: 19) and reverse primer ATGACGGCATGTACCAACCA (SEQ ID NO: 20) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TTGGTCCCCTCAGTTCTATGCTGTTGTGT (SEQ ID NO: 21) linked to a fluorescent label. 
     
     
         31 . The method of  claim 27 , wherein KIT nucleic acid is amplified utilizing forward primer GCACCTGCTGAAATGTATGACATAAT (SEQ ID NO: 22) and reverse primer TTTGCTAAGTTGGAGTAAATATGATTGG (SEQ ID NO: 23) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGC (SEQ ID NO: 24) linked to a fluorescent label. 
     
     
         32 . The method of  claim 27 , wherein SYNGR2 nucleic acid is amplified utilizing forward primer GCTGGTGCTCATGGCACTT (SEQ ID NO: 31) and reverse primer CCCTCCCCAGGCTTCCTAA (SEQ ID NO: 32) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence AAGGGCTTTGCCTGACAACACCCA (SEQ ID NO: 33) linked to a fluorescent label. 
     
     
         33 . The method of  claim 27 , wherein C11 or f8 nucleic acid is amplified utilizing forward primer CCGGCCCAAGCTCCAT (SEQ ID NO: 13) and reverse primer TTGTGTAACCGTCGGTCATGA (SEQ ID NO: 14) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TGTTTGGTGGAATCCATGAAGGTTATGGC (SEQ ID NO: 15) linked to a fluorescent label. 
     
     
         34 . The method of  claim 27 , wherein CDH1 nucleic acid is amplified utilizing forward primer TGAGTGTCCCCCGGTATCTTC (SEQ ID NO: 28) and reverse primer CAGCCGCTTTCAGATTTTCAT (SEQ ID NO: 29) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CCTGCCAATCCCGATGAAATTGGAAAT (SEQ ID NO: 30) linked to a fluorescent label. 
     
     
         35 . The method of  claim 27 , wherein IMPACT nucleic acid is amplified utilizing forward primer ATGGCAGTGCAGTCATCATCTT (SEQ ID NO: 10) and reverse primer GCATTCATACAGCTGCTTACCATCT (SEQ ID NO: 11) and the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TTTGGTCCCTGCCTAGGACCGGG (SEQ ID NO: 12) linked to a fluorescent label. 
     
     
         36 . The method of  claim 27 , wherein FAM13A1 nucleic acid is amplified utilizing forward primer TGAAGAATGTCATGGTGGTAGTATCA (SEQ ID NO: 25) and reverse primer ATGACTCCTCAGGTGAATTTGTGTAG (SEQ ID NO: 26) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CTGGTATGGAGGGATTCTGCTAGGACCAG (SEQ ID NO: 27) linked to a fluorescent label. 
     
     
         37 . The method of  claim 27 , wherein KIAA1128 nucleic acid is amplified utilizing forward primer GAGAGCGTGATCCCCCTACA (SEQ ID NO: 16) and reverse primer ACCAAGAGTGCACCTCAGTGTCT (SEQ ID NO: 17) and the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TCACTTCCAAATGTTCCTGTAGCATAAATGGTG (SEQ ID NO: 18) linked to a fluorescent label. 
     
     
         38 . The method of  claim 18 , wherein expression of the nucleic acid(s) is measured by detecting the protein expression product of the nucleic acid(s).

Join the waitlist — get patent alerts

Track US2011177971A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.