Micro-RNA Associated With Rheumatoid Arthritis

Abstract

An object of the present invention is to provide a novel marker for rheumatoid arthritis (RA), and more specifically, to provide a marker whose expression may be specifically increased or decreased in RA. Another object of the present invention is to confirm whether or not miRNA serving as the marker is involved as the etiology of RA, and to provide an inspection method for RA and a therapeutic agent for RA each using the miRNA involved. The marker includes miRNA (for example, miR124a) whose expression is specifically increased or decreased in RA synovial cells based on a small RNA expression profile in the RA synovial cells. In addition, the therapeutic agent for RA includes miRNA (for example, miR124a) as an active ingredient.

1 . (canceled) 
     
     
         2 . (canceled) 
     
     
         3 . A marker for rheumatoid arthritis, comprising miR-124a whose expression is specifically decreased in rheumatoid arthritis. 
     
     
         4 . A marker for rheumatoid arthritis according to  claim 3 , wherein the marker for rheumatoid arthritis has a base sequence selected from the following: 
       
         
           
                 
                 
                 
               
                     
                   (1) UUAAGGCACGCGGUGAAUGCCA; 
                   (SEQ ID NO: 1) 
                 
             
                
               
            
           
         
       
       and
 (2) a base sequence having substitutions, deletions, additions, or insertions of one or two nucleotides in an oligonucleotide formed of a base sequence according to the above-mentioned item (1). 
 
     
     
         5 . An inspection method for rheumatoid arthritis, comprising using as an indicator the marker for rheumatoid arthritis according to  claim 3 . 
     
     
         6 . An inspection method for rheumatoid arthritis, comprising the following steps:
 (1) quantifying a marker for rheumatoid arthritis (A) in a collected biological sample using the marker for rheumatoid arthritis according to  claim 3  as an indicator; and   (2) comparing a quantitative value for the marker for rheumatoid arthritis (A) quantified as described above to a quantitative value for a marker for rheumatoid arthritis (B) in a biological sample free from rheumatoid arthritis.   
     
     
         7 . An inspection method for rheumatoid arthritis according to  claim 6 , wherein the quantitative values for the marker for rheumatoid arthritis (A) and the marker for rheumatoid arthritis (B) represent amounts of oligonucleotides as those markers. 
     
     
         8 . An inspection method for rheumatoid arthritis according to  claim 6 , comprising making a diagnosis of rheumatoid arthritis when the quantitative value for the marker for rheumatoid arthritis (A) is lower than the quantitative value for the marker for rheumatoid arthritis (B). 
     
     
         9 . A therapeutic agent for rheumatoid arthritis, comprising, as an active ingredient, an oligonucleotide formed of a base sequence selected from the following: 
       
         
           
                 
                 
                 
               
                     
                   (1) UUAAGGCACGCGGUGAAUGCCA; 
                   (SEQ ID NO: 1) 
                 
             
                
               
            
           
         
       
       and
 (2) a base sequence having substitutions, deletions, additions, or insertions of one or two nucleotides in an oligonucleotide formed of a base sequence according to the above-mentioned item (1). 
 
     
     
         10 . A therapeutic agent for rheumatoid arthritis, comprising, as an active ingredient, an oligonucleotide that forms miR-124a.