Mammalian receptors as targets for antibody and active vaccination therapy against mold infections

Abstract

The present invention provides therapeutic compositions and methods for treating and preventing fungal disease or conditions including mucormycosis. The therapeutic methods and compositions of the invention include antibody, antibody fragment, siRNA and vaccine compositions having or directed against a GRP78 polypeptide or an antigenic fragment of the polypeptide.

1 . A pharmaceutical composition for treating or preventing a fungal condition in a subject in need thereof, comprising an antibody or antibody fragment thereof that specifically binds to a GRP78 polypeptide or a fragment thereof; and a pharmaceutically acceptable excipient or carrier. 
     
     
         2 . A pharmaceutical composition for treating or preventing a fungal condition in a subject in need thereof, comprising a small interfering RNA comprising the nucleotide sequence CTTGTTGGTGGCTCGACTCGA (SEQ ID NO. 1); and a pharmaceutically acceptable excipient or carrier. 
     
     
         3 . A vaccine composition for immunization of a subject against a fungal condition, comprising a GRP78 polypeptide, or an antigenic fragment of said polypeptide, and a pharmaceutically acceptable carrier. 
     
     
         4 . The vaccine composition of  claim 3 , further comprising an adjuvant. 
     
     
         5 . A method of treating or preventing a fungal condition, comprising administering a composition to a subject having, or susceptible to having, a fungal condition, wherein said composition comprises: a therapeutically effective amount of an antibody or antibody fragment thereof that specifically binds to a GRP78 polypeptide or a fragment thereof; an immunogenic amount of a GRP78 polypeptide, or an immunogenic fragment thereof; or a therapeutically effective amount of a small interfering RNA comprising the nucleotide sequence CTTGTTGGTGGCTCGACTCGA (SEQ ID NO. 1). 
     
     
         6 . The method of  claim 5 , wherein the immunogenic amount of a GRP78 polypeptide is administered with a pharmaceutically acceptable medium or adjuvant. 
     
     
         7 . The method of  claim 5 , wherein said preventing comprises prophylactic administration of said antibody or antibody fragment thereof prior to onset of said fungal condition. 
     
     
         8 . The method of  claim 5 , wherein said fungal condition comprises zygomycosis, aspergillosis, cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis, paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis, penicilliosis or sporotrichosis. 
     
     
         9 . The method of  claim 8 , wherein said zygomycosis further comprises mucormycosis. 
     
     
         10 . The method of  claim 9 , wherein said mucormycosis comprises rhinocerebral mucormycosis, pulmonary mucormycosis, gastrointestinal mucormycosis, disseminated mucormycosis, bone mucormycosis, mediastinum mucormycosis, trachea mucormycosis, kidney mucormycosis, peritoneum mucormycosis, superior vena cava mucormycosis or external otitis mucormycosis. 
     
     
         11 . The method of  claim 9 , wherein said mucormycosis is associated with an infectious agent within the order Mucorales. 
     
     
         12 . The method of  claim 11 , wherein said agent within the order Mucorales is selected from the fungi families of Choanephoraceae; Cunninghamellaceae; Mucoraceae; Mycotyphaceae; Phycomycetaceae; Pilobolaceae; Saksenaeaceae; Syncephalastraceae; or Umbelopsidaceae. 
     
     
         13 . The method of  claim 11 , wherein said agent within the order Mucorales is selected from the genera of  Rhizopus, Absidia, Apophysomyces, Mucor,  or  Cunninghamell.    
     
     
         14 . The method of  claim 13 , wherein said agent within the genera of  Rhizopus, Absidia, Apophysomyces, Mucor,  or  Cunninghamell  is selected from  Rhizopus oryzae, Rhizopus microsporus, Rhizopus microsporus var. rhizopodiformis, Absidia corymbifera, Apophysomyces elegans,  or  Rhizomucor pusillus    
     
     
         15 . The method of  claim 5 , wherein said subject is human. 
     
     
         16 . The method of  claim 5 , wherein the subject is immunocompromised. 
     
     
         17 . The method of  claim 5 , wherein the subject is suffering from diabetes mellitus. 
     
     
         18 . The method of  claim 5 , wherein the subject is suffering from diabetic ketoacidosis.