Retinoid metabolizing protein

Abstract

Amino acid sequences and corresponding nucleic acid sequence of retinoid metabolizing protein found in human, mouse and zebrafish are described, as well as methods of using same.

1 . A method of screening drugs for their effect on expression of a gene wherein the gene is inducible by a retinoid, comprising:
 (A) exposing a recombinant DNA to a said drug, and   (B) determining the effect on gene expression,   wherein the recombinant DNA comprises:   (i) a nucleotide sequence selected from the group consisting of:
 (a) SEQ ID NO:33; 
 (b) SEQ ID NO:34; 
 (c) SEQ ID NO:35; and 
 (d) a fragment of (a), (b) or (c), wherein said DNA fragment possesses promoter activity; and 
   (ii) at least one structural gene.   
     
     
         2 . The method of  claim 1  including exposing the recombinant DNA in the presence of a said retinoid. 
     
     
         3 . The method of  claim 1  wherein the at least one structural gene comprises a reporter gene that does not metabolize retinoic acid. 
     
     
         4 . The method of  claim 1  wherein the at least one structural gene comprises at least one cytochrome P450. 
     
     
         5 . The method of  claim 1  wherein determining the effect on gene expression includes ascertaining the effect on transcription of the gene. 
     
     
         6 . The method of  claim 2  wherein the retinoid is a retinoic acid. 
     
     
         7 . The method of  claim 6  wherein the retinoic acid is all-trans-retinoic acid. 
     
     
         8 . The method of  claim 1  wherein said recombinant DNA includes the sequence TGAACTNNNNNTGAACT, where “N” can be any nucleotide and there can be 0 to 5 N (SEQ ID NO:39). 
     
     
         9 . The method of  claim 8  wherein there are 5 N. 
     
     
         10 . The method of  claim 8  wherein said recombinant DNA further includes the sequence TCTGASSAAGKTAAC (SEQ ID NO:40) downstream from the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39). 
     
     
         11 . The method of  claim 10  wherein said recombinant DNA further includes the sequence AATT between the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and the sequence TCTGASSAAGKTAAC (SEQ ID NO:40). 
     
     
         12 . The method of  claim 10  wherein there are up to six nucleotides between the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and the sequence TCTGASSAAGKTAAC (SEQ ID NO:40). 
     
     
         13 . The method of  claim 8  wherein said recombinant DNA further includes the sequence CAATTAAAGA (SEQ ID NO:41) upstream of the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39). 
     
     
         14 . The method of  claim 1  wherein said recombinant DNA includes the sequence CAATTAAAGATGAACTTTGGGTGAACTAATT (SEQ ID NO:42). 
     
     
         15 . The method of any of  claims 1  to  14  wherein said recombinant DNA includes the sequence TATAA. 
     
     
         16 . The method of  claim 8 ,  9  or  13  wherein said recombinant DNA includes the sequence TATAA downstream of the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39). 
     
     
         17 . The method of  claim 10  or  11  wherein said recombinant DNA includes the sequence TATAA downstream of the sequence TCTGASSAAGKTAAC (SEQ ID NO:40). 
     
     
         18 . The method of  claim 8  wherein said recombinant DNA includes the sequence TATAA located downstream of the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and spaced up to about 55 nucleotides therefrom.