US2009281165A1PendingUtilityA1

Antisense oligonucleotide against human acetylcholinesterase (AChE) and uses thereof

Assignee: YISSUM RES DEV COPriority: May 24, 2001Filed: Oct 7, 2008Published: Nov 12, 2009
Est. expiryMay 24, 2021(expired)· nominal 20-yr term from priority
A61P 25/00A61P 21/04A61K 38/00C12N 2310/315A61P 21/00C12N 2310/321A61P 21/02C12N 2310/53C12Y 301/01007C12N 15/1137
57
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention relates to an antisense oligonucleotide targeted to the coding region of the human acetylcholinesterase (AChE), which selectively suppresses the AChE-R isoform of the enzyme. The antisense oligonucleotide is intended for use in the treatment and/or prevention of neuromuscular disorders, preferably myasthenia gravis. In addition, it can penetrate the blood-brain barrier (BBB) and destroy AChE-R within central nervous system neurons, while also serving as a carrier to transport molecules across the BBB.

Claims

exact text as granted — not AI-modified
1 . A synthetic antisense oligodeoxynucleotide targeted against human AChE mRNA having the nucleotide sequence: 
       
         
           
                 
                 
                 
               
                     
                   5′ CTGCCACGTTCTCCTGCACC 3′. 
                   (SEQ ID NO: 1) 
                 
             
                
               
            
           
         
       
     
     
         2 . A synthetic nuclease resistant antisense oligodeoxynucleotide having the nucleotide sequence: 
       
         
           
                 
                 
                 
               
                     
                   5′ CTGCCACGTTCTCCTGCACC 3′. 
                   (SEQ ID NO: 1) 
                 
             
                
               
            
           
         
       
     
     
         3 . A synthetic antisense oligodeoxynucleotide of  claim 2 , which is a modified oligodeoxynucleotide comprising partially unsaturated aliphatic hydrocarbon chain and one or more polar or charged groups including carboxylic acid groups, ester groups, and alcohol groups. 
     
     
         4 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 2  or  3 , wherein at least one of the three 3′-terminus nucleotides is 2′-O-methylated. 
     
     
         5 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 4 , in which the last three 3′-terminus nucleotides are 2′-O-methylated. 
     
     
         6 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 2 , wherein at least one nucleotide is fluoridated. 
     
     
         7 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 2  or  claim 3 , having phosphorothioate bonds linking between at least two of the last 3′-terminus nucleotide bases. 
     
     
         8 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 7 , having phosphorothioate bonds linking between the last four 3′-terminus nucleotide bases. 
     
     
         9 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 3 , having a nucleotide loop forming sequence at the 3′-terminus. 
     
     
         10 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 9 , wherein said loop is a 9-nucleotide loop having the nucleotide sequence CGCGAAGCG (SEQ ID NO:2). 
     
     
         11 . A synthetic nuclease resistant antisense oligodeoxynucleotide of any one of  claims 1  to  10 , capable of selectively modulating human AChE production. 
     
     
         12 . A synthetic nuclease resistant antisense oligodeoxynucleotide of  claim 11 , capable of selectively modulating human AChE production in the central nervous system. 
     
     
         13 . A pharmaceutical composition comprising the antisense oligonucleotide hEN101, defined by SEQ ID NO:1. 
     
     
         14 . The pharmaceutical composition of  claim 13 , for the treatment and/or prevention of a progressive neuromuscular disorder, for improving stamina and/or for use in chronic muscle fatigue. 
     
     
         15 . The pharmaceutical composition of  claim 13  for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is selected from myasthenia gravis, Eaton-Lambert disease, muscular dystrophy, amyotrophic lateral sclerosis, post-traumatic stress disorder (PTSD), multiple sclerosis, dystonia, post-stroke sclerosis, post-injury muscle damage, excessive re-innervation, post-surgery paralysis of unknown origin, and post-exposure to AChE inhibitors. 
     
     
         16 . The pharmaceutical composition of  claim 13 , for the treatment and/or prevention of myasthenia gravis. 
     
     
         17 . The pharmaceutical composition of  claim 13 , for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with an excess of AChE mRNA or protein. 
     
     
         18 . The pharmaceutical composition of  claim 13 , for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with an excess of AChE-R mRNA. 
     
     
         19 . The pharmaceutical composition of  claim 13 , for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder is associated with impairment of cholinergic transmission. 
     
     
         20 . The pharmaceutical composition of  claim 13 , for use in treating or preventing a progressive neuromuscular disorder, wherein said disorder involves muscle distortion, muscle re-innervation or neuro-muscular junction (NMJ) abnormalities. 
     
     
         21 . The pharmaceutical composition of any one of  claims 13 - 20 , which is for daily use by a patient of a dosage of active ingredient between about 0.001 μg/g and about 50 μg/g. 
     
     
         22 . The pharmaceutical composition of anyone of  claims 13 - 20 , wherein the treatment and/or prevention comprises administering a dosage of active ingredient of about 0.01 to about 5.0 μg/g. 
     
     
         23 . The pharmaceutical composition of any one of  claims 13 - 20 , wherein the treatment and/or prevention comprises administering a dosage of active ingredient of about 0.15 to about 0.50% g/g. 
     
     
         24 . The pharmaceutical composition of  claim 13 , optionally comprising at least one additional active agent. 
     
     
         25 . A pharmaceutical composition comprising an antisense oligodeoxynucleotide as denoted by SEQ ID NO:1, for facilitating passage of compounds through the BBB, optionally further comprising additional pharmaceutically active agent to be transported through the BBB, and/or pharmaceutically acceptable adjuvant, carrier or diluent. 
     
     
         26 . The pharmaceutical composition of  claim 25 , wherein said additional pharmaceutically active agent is selected from any one of contrast agents used for central nervous system imaging, agents that function to block the effects of abused drugs, antibiotics, chemotherapeutic drugs and vectors to be used in gene therapy. 
     
     
         27 . A method of preparation of a pharmaceutical composition comprising the step of admixing the antisense oligonucleotide hEN101, defined by SEQ ID NO:1, with a pharmaceutically acceptable adjuvant, carrier or diluent, and optionally with at least one additional active agent. 
     
     
         28 . The method of  claim 27 , wherein said composition is intended for the treatment and/or prevention of a progressive neuromuscular disorder, for improving stamina and/or for use in chronic muscle fatigue.

Join the waitlist — get patent alerts

Track US2009281165A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.