Method for detecting bacteria of the genus mycobacterium (acid-fast bacteria) and kit for the same

Abstract

An object of the present invention is to provide an oligonucleotide for rapidly and conveniently detecting bacteria of the genus Mycobacterium (acid-fast bacteria) or for identifying the bacterial species thereof, and a method and kit for detecting bacteria of the genus Mycobacterium (acid-fast bacteria) using such oligonucleotid. The present invention provides a method for identifying Mycobacterium tuberculosis , which comprises performing a nucleic acid amplification reaction using a primer for nucleic acid amplification that comprises a nucleotide sequence corresponding to a variable region in a 16S rRNA gene sequence of Mycobacterium tuberculosis and has at least 3 continuous nucleotides contained in the nucleotide sequence represented by SEQ ID NO: 1 at the 3′ end.

1 . A method for identifying one of  Mycobacterium tuberculosis, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium kansasi , and which comprises performing a nucleic acid amplification reaction using at least 2 primers which are selected from the following (a) to (d):
 (a) a primer for nucleic acid amplification that is a nucleotide sequence of at least 15 or more continuous nucleotides contained in the nucleotide sequence represented by SEQ ID NO: 3 and comprises a nucleotide sequence containing at least 3 or more nucleotides consisting of G (the nucleotide 26) and the following nucleotides on the 3′ side in SEQ ID NO: 3;   (b) a primer for nucleic acid amplification that is a nucleotide sequence of at least 15 or more continuous nucleotides contained in the nucleotide sequence represented by SEQ ID NO: 6 and comprises a nucleotide sequence containing at least 3 or more nucleotides consisting of G (the nucleotide 26) and the following nucleotides on the 3 side in SEQ ID NO: 6;   (c) a primer for nucleic acid amplification that is a nucleotide sequence of at least 15 or more continuous nucleotides contained in the nucleotide sequence represented by SEQ ID NO: 9 and comprises a nucleotide sequence containing at least 3 or more nucleotides consisting of G (the nucleotide 26) and the following nucleotides on the 3′ side in SEQ ID NO: 9; and   (d) a primer for nucleic acid amplification that is a nucleotide sequence of at least 15 or more continuous nucleotides contained in the nucleotide sequence represented by SEQ ID NO: 25 and comprises a nucleotide sequence containing at least 3 or more nucleotides consisting of G (the nucleotide 26) and the following nucleotides on the 3′ side in SEQ ID NO: 25;   and differentiating bacterial species based on the presence or the absence of amplification reaction.   
     
     
         2 . The method according to  claim 1 , which comprises detecting a by-product of a nucleic acid amplification reaction. 
     
     
         3 . The method according to  claim 2 , wherein the by-product of the nucleic acid amplification reaction is pyrophosphoric acid. 
     
     
         4 . The method according to  claim 3 , wherein pyrophosphoric acid is detected using a dry analytical element. 
     
     
         5 . The method according to  claim 1  wherein the primer of item (a) is ataccggataggaccacg (SEQ ID NO.10), taccggataggaccac (SEQ ID NO.14) or cggataggaccacgggat (SEQ ID NO.20); the primer of item (b) is ataccggataggacctca (SEQ ID NO.11), ataccggataggacctcaa (SEQ ID NO.15), taccggataggacctca (SEQ ID NO.16), taccggataggacctcaa (SEQ ID NO.17) or taccggataggacctcaagac (SEQ ID NO.21); the primer of item (c) is aataccggataggaccttt (SEQ ID NO.12), ataccggataggaccttta (SEQ ID NO.18), tacoggataggaccttta (SEQ ID NO.19), or ataceggataggacetttagg (SEQ ID NO.22); and the primer of item (d) is ataccggataggaccacttg (SEQ ID NO.26) or taccggataggaccacttg (SEQ ID NO.27).