US2009004169A1PendingUtilityA1
Nucleic Acids For Inhibiting Hairless Protein Expression and Methods of Use Thereof
Individually held — no corporate assignee on recordPriority: Apr 13, 2001Filed: Jun 16, 2008Published: Jan 1, 2009
Est. expiryApr 13, 2021(expired)· nominal 20-yr term from priority
Inventors:Angela M. Christiano
A61K 38/00C12N 15/113C12N 2310/12A61P 17/00A61P 17/14
69
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present invention provides DNAzymes and ribozymes that specifically cleave Hairless protein mRNA. The present invention also provides antisense oligonucleotides that specifically inhibit translation of Hairless Protein mRNA. The present invention also provides various methods of inhibiting the expression of Hairless Protein. Finally the invention provides pharmaceutical compositions containing the instant DNAzymes, ribozymes and antisense oligonucleotides as active ingredients.
Claims
exact text as granted — not AI-modified1 . A catalytic deoxyribonucleic acid molecule that specifically cleaves Hairless Protein mRNA comprising:
(a) a catalytic domain that cleaves mRNA at a defined consensus sequence; (b) a binding domain contiguous with the 5′ end of the catalytic domain; and (c) a binding domain contiguous with the 3′ end of the catalytic domain, wherein the binding domains are complementary to, and therefore hybridize with, the two regions flanking the defined consensus sequence within the Hairless Protein mRNA at which cleavage is desired, and wherein each binding domain is at least 4 residues in length and both binding domains have a combined total length of at least 8 residues, and wherein the catalytic domain has the sequence ggctagctacaacga (SEQ ID NO: 18), and cleaves mRNA at the consensus sequence purine:pyrimidine.
2 . The catalytic deoxyribonucleic acid molecule of claim 1 , wherein the molecule has a sequence selected from the group consisting of:
(a)
cggcccaggctagctacaacgaggtgcag;
(SEQ ID NO:3)
(b)
ctcaggaggctagctacaacgagcccctc;
(SEQ ID NO:4)
(c)
gggagcaggctagctacaacgagtccttg;
(SEQ ID NO:5)
(d)
ctccccaggctagctacaacgatctgggg;
(SEQ ID NO:6)
(e)
cagccagggctagctacaacgatgacctt;
(SEQ ID NO:7)
(f)
cagcggaggctagctacaacgagggtaag;
(SEQ ID NO:8)
(g)
cgcagaaggctagctacaacgagccagcg;
(SEQ ID NO:9)
(h)
tgcggggggctagctacaacgacaggggc;
(SEQ ID NO:10)
(i)
aggggtgggctagctacaacgaggggtca;
(SEQ ID NO:11)
(j)
cccggagggctagctacaacgaataccca;
(SEQ ID NO:12)
(k)
gcctaagggctagctacaacgatgaaggc;
(SEQ ID NO:13)
(l)
gcaaggaggctagctacaacgatctgctg;
(SEQ ID NO:14)
(m)
gttcccaggctagctacaacqacgcctgg;
(SEQ ID NO:15)
(n)
cagctggggctagctacaacgaacccaag;
(SEQ ID NO:16)
and
(o)
cccatggggctagctacaacgagcagtcc.
(SEQ ID NO:2)
3 . A catalytic ribonucleic acid molecule that specifically cleaves Hairless Protein mRNA comprising:
(a) a catalytic domain that cleaves mRNA at a defined consensus sequence; (b) a binding domain contiguous with the 5′ end of the catalytic domain; and (c) a binding domain contiguous with the 3′ end of the catalytic domain, wherein the binding domains are complementary to, and therefore hybridize with, the two regions flanking the defined consensus sequence within the Hairless Protein mRNA at which cleavage is desired, and wherein each binding domain is at least 4 residues in length and both binding domains have a combined total length of at least 8 residues, and wherein the catalytic domain has the sequence CTGATGAGTCCGTGAGGACGAAACA (SEQ ID NO: 19), and cleaves mRNA at the consensus sequence 5′-NUH-3′.
4 . The catalytic ribonucleic acid molecule of claim 3 , wherein the molecule is a hammerhead ribozyme or a hairpin ribozyme.
5 . The catalytic ribonucleic acid molecule of claim 3 , wherein the molecule has a sequence selected from the group consisting of:
(a)
cggccggcgggcgagctgatgagtccgtgagg
(SEQ ID NO:20)
acgaaacacgcgttctcccgctct;
(b)
gagtctggggtgctcagctgatgagtccgtga
(SEQ ID NO:21)
ggacgaaacacgcccctccaaaagg;
(c)
ttgctgcccagccagttctgatgagtccgtga
(SEQ ID NO:22)
ggacgaaacaccttcctctccccatt;
(d)
gctctgggggcaggccactgatgagtccgtga
(SEQ ID NO:23)
ggacgaaaca cactaggtagggtggc;
(e)
atgaacaaggcctggggctgatgagtccgtga
(SEQ ID NO:24)
ggacgaaaca caagcgggccaggagg;
and
(f)
tcgcctggcccagcccactgatgagtccgtga
(SEQ ID NO:25)
ggacgaaaca cgttgccaagagtatg.
6 . The catalytic nucleic acid molecule of claim 1 or 3 , wherein the cleavage site within the Hairless protein mRNA is located within the first 1500 residues following the mRNA's 5′ terminus.
7 . The catalytic nucleic acid molecule of claim 1 or 3 , wherein the Hairless Protein mRNA is from a subject selected from the group consisting of human, monkey, rat and mouse.
8 . The catalytic nucleic acid molecule of claim 1 or 3 , wherein the Hairless protein mRNA has the sequence of SEQ ID NO:1.
9 . A pharmaceutical composition comprising the catalytic nucleic acid molecule of claim 1 or 3 and a pharmaceutically acceptable carrier.
10 . The pharmaceutical composition of claim 9 , wherein the carrier is selected from the group consisting of an alcohol, an ethylene glycol and a liposome.
11 . A method of specifically cleaving Hairless Protein mRNA comprising contacting the mRNA with the catalytic nucleic acid molecule of claim 1 or 3 under conditions permitting the molecule to cleave the mRNA.
12 . A method of specifically cleaving Hairless Protein mRNA in a cell, comprising contacting the cell containing the mRNA with the catalytic nucleic acid molecule of claim 1 or 3 so as to specifically cleave the Hairless Protein mRNA in the cell.
13 . A method of specifically inhibiting the expression of Hairless Protein in a cell that would otherwise express Hairless Protein, comprising contacting the cell with the catalytic nucleic acid molecule of claim 1 or 3 so as to specifically inhibit the expression of Hairless Protein in the cell.
14 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells, comprising administering to the subject an amount of the catalytic nucleic acid molecule of claim 1 or 3 effective to specifically inhibit the expression of Hairless Protein in the subject's cells.
15 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells comprising administering to the subject an amount of the pharmaceutical composition of claim 9 effective to specifically inhibit the expression of Hairless Protein in the subject's cells.
16 . A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the catalytic nucleic acid of claim 1 or 3 .
17 . A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of claim 9 .
18 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the catalytic nucleic acid of claim 1 or 3 .
19 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the pharmaceutical composition of claim 9 .
20 . The method of claim 12 , wherein the cell is a keratinocyte.
21 . The method of claim 13 , wherein the cell is a keratinocyte.
22 . The method of claim 14 , wherein the cell is a keratinocyte.
23 . The method of claim 15 , wherein the cell is a keratinocyte.
24 . The method of claim 14 wherein the subject is a human.
25 . The method of claim 15 , wherein the subject is a human.
26 . The method of claim 17 , wherein the subject is a human.
27 . The method of claim 14 , wherein the catalytic nucleic acid molecule is administered topically.
28 . The method of claim 27 , wherein the catalytic nucleic acid molecule is administered dermally.
29 . The method of claim 15 , wherein the pharmaceutical composition is administered topically.
30 . The method of claim 29 , wherein the pharmaceutical composition is administered dermally.
31 . The method of claim 17 , wherein the pharmaceutical composition is administered topically.
32 . The method of claim 31 , wherein the pharmaceutical composition is administered dermally.
33 . A vector which comprises a sequence encoding the catalytic nucleic acid molecule of claim 1 or 3 .
34 . A host-vector system comprising a cell having the vector of claim 33 therein.
35 . A method of producing the catalytic nucleic acid molecule of claim 1 or 3 comprising culturing a cell having therein a vector comprising a sequence encoding said catalytic nucleic acid molecule under conditions permitting the expression of the catalytic nucleic acid molecule by the cell.
36 . A nucleic acid molecule that specifically hybridizes to Hairless Protein mRNA so as to inhibit the translation thereof in a cell, wherein the nucleic acid molecule comprises consecutive nucleotides having the sequence of SEQ ID NO:27.
37 . A vector that comprises a sequence encoding the nucleic acid molecule of claim 36 .
38 . A host-vector system comprising a cell having the vector of claim 37 therein.
39 . A pharmaceutical composition comprising (a) the nucleic acid molecule of claim 36 or the vector of claim 37 and (b) a pharmaceutically acceptable carrier.
40 . The pharmaceutical composition of claim 39 , wherein the carrier is selected from the group consisting of an alcohol, ethylene glycol and a liposome.
41 . A method of specifically inhibiting the expression of Hairless Protein in a cell that would otherwise express Hairless Protein, comprising contacting the cell with the nucleic acid molecule of claim 36 so as to specifically inhibit the expression of Hairless Protein in the cell.
42 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells comprising administering to the subject an amount of the nucleic acid molecule of claim 36 effective to specifically inhibit the expression of Hairless Protein in the subject's cells.
43 . A method of specifically inhibiting the expression of Hairless Protein in a subject's cells comprising administering to the subject an amount of the pharmaceutical composition of claim 39 effective to specifically inhibit the expression of Hairless Protein in the subject's cells.
44 . A method of inhibiting hair production by a hair-producing cell comprising contacting the cell with an effective amount of the nucleic acid molecule of claim 36 .
45 . A method of inhibiting hair growth in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of claim 39 .
46 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the nucleic acid molecule of claim 36 .
47 . A method of inhibiting the transition of a hair follicle from the anagen phase to the catagen phase comprising contacting the follicle with an effective amount of the pharmaceutical composition of claim 39 .
48 . The method of claim 41 , wherein the cell is a keratinocyte.
49 . The method of claim 42 , wherein the cell is a keratinocyte.
50 . The method of claim 43 , wherein the cell is a keratinocyte.
51 . The method of claim 44 , wherein the cell is a keratinocyte.
52 . The method of claim 42 , wherein the subject is a human.
53 . The method of claim 43 , wherein the subject is a human.
54 . The method of claim 45 , wherein the subject is a human.
55 . The method of claim 42 , wherein the nucleic acid molecule is administered topically.
56 . The method of claim 56 , wherein the nucleic acid is administered dermally.
57 . The method of claim 44 , wherein the pharmaceutical composition is administered topically.
58 . The method of claim 57 , wherein the pharmaceutical composition is administered dermally.
59 . The method of claim 45 , wherein the pharmaceutical composition is administered topically.
60 . The method of claim 59 , wherein the pharmaceutical composition is administered dermally.
61 . The nucleic acid molecule of claim 36 , wherein the Hairless Protein mRNA has the sequence as set forth in SEQ ID NO:1.Join the waitlist — get patent alerts
Track US2009004169A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.