US2006281133A1PendingUtilityA1

Targeted fusion proteins and methods for the characterization of cellular membrane domains

Assignee: RODGERS WILLIAMPriority: Jul 9, 2001Filed: Apr 27, 2006Published: Dec 14, 2006
Est. expiryJul 9, 2021(expired)· nominal 20-yr term from priority
G01N 33/92C07K 2319/60C07K 14/705C07K 2319/033G01N 33/5041C12N 9/1205C07K 2319/00C07K 2319/02
51
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Cell membranes containing glycolipid-enriched membrane (GEM) and non-glycolipid-enriched membrane (non-GEM) domains are targeted using fusion proteins that are anchored in the cell membrane. Fusion proteins to target GEM (or non-GEM) domains are comprised of a selected fluorescent polypeptide, a membrane-targeting sequence of p56 Lck (or pp60 c-Src for non-GEM domains) and a linker inserted between the polypeptide and the membrane targeting sequence. Localization of fusion proteins in GEM and non-GEM domains is assessed using techniques including confocal microscopy, fluorescence-based techniques, and membrane fractionation. Using these techniques, compounds are screened for their effect on GEM and non-GEM domains of live cells. These fusion proteins therefore represent useful tools for studying subcellular trafficking and the function of discrete compartments in the plasma membrane.

Claims

exact text as granted — not AI-modified
1 - 20 . (canceled)  
     
     
         21 . A polynucleotide that encodes a fusion protein comprising: 
 (a) a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src ;    (b) a fluorescent protein; and    (c) a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein.    
     
     
         22 . The polynucleotide of  claim 21 , wherein said targeting sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or20 amino acid residues in length.  
     
     
         23 . The polynucleotide of  claim 21 , wherein said targeting sequence is the first 15 amino acid residues of pp60 c-Scr .  
     
     
         24 . The polynucleotide of  claim 21 , wherein said targeting sequence and said linker are encoded by the oligonucleotide  
       
         
           
                 
                 
               
                     
                 
                   ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAA 
                     
                 
                     
                 
                   CAACAA. 
                 
                     
                 
             
                
                
                
                
                
               
            
           
         
       
     
     
         25 . The polynucleotide of  claim 21 , wherein said linker is a poly-glutamine peptide of about 4 amino acid residues in length.  
     
     
         26 . The polynucleotide of  claim 21 , wherein the fluorescent protein is green fluorescent protein, yellow fluorescent protein or cyan fluorescent protein.  
     
     
         27 - 30 . (canceled)  
     
     
         31 . An expression vector comprising a polynucleotide comprising: 
 (a) a fusion protein coding region comprising: 
 (i) a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src ;  
 (ii) a fluorescent protein;  
 (iii) a linker inserted between, and covalently bound to, said membrane targeting sequence of said fluorescent protein; and  
   (b) a promoter operatively linked to said fusion protein coding region.    
     
     
         32 . The expression vector of  claim 31 , wherein said expression vector is pWay20.  
     
     
         33 . The expression vector of  claim 31 , wherein said promoter is a cytomegalovirus (CMV) promoter.  
     
     
         34 . The expression vector of  claim 31 , wherein the fluorescent protein is green fluorescent protein, yellow fluorescent protein or cyan fluorescent protein.  
     
     
         35 - 70 . (canceled)

Join the waitlist — get patent alerts

Track US2006281133A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.