Targeted fusion proteins and methods for the characterization of cellular membrane domains

Abstract

Cell membranes containing glycolipid-enriched membrane (GEM) and non-glycolipid-enriched membrane (non-GEM) domains are targeted using fusion proteins that are anchored in the cell membrane. Fusion proteins to target GEM (or non-GEM) domains are comprised of a selected fluorescent polypeptide, a membrane-targeting sequence of p56 Lck (or pp60 c-Src for non-GEM domains) and a linker inserted between the polypeptide and the membrane targeting sequence. Localization of fusion proteins in GEM and non-GEM domains is assessed using techniques including confocal microscopy, fluorescence-based techniques, and membrane fractionation. Using these techniques, compounds are screened for their effect on GEM and non-GEM domains of live cells. These fusion proteins therefore represent useful tools for studying subcellular trafficking and the function of discrete compartments in the plasma membrane.

1 - 20 . (canceled)  
     
     
         21 . A polynucleotide that encodes a fusion protein comprising: 
 (a) a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src ;    (b) a fluorescent protein; and    (c) a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein.    
     
     
         22 . The polynucleotide of  claim 21 , wherein said targeting sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or20 amino acid residues in length.  
     
     
         23 . The polynucleotide of  claim 21 , wherein said targeting sequence is the first 15 amino acid residues of pp60 c-Scr .  
     
     
         24 . The polynucleotide of  claim 21 , wherein said targeting sequence and said linker are encoded by the oligonucleotide  
       
         
           
                 
                 
               
                     
                 
                   ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAA 
                     
                 
                     
                 
                   CAACAA. 
                 
                     
                 
             
                
                
                
                
                
               
            
           
         
       
     
     
         25 . The polynucleotide of  claim 21 , wherein said linker is a poly-glutamine peptide of about 4 amino acid residues in length.  
     
     
         26 . The polynucleotide of  claim 21 , wherein the fluorescent protein is green fluorescent protein, yellow fluorescent protein or cyan fluorescent protein.  
     
     
         27 - 30 . (canceled)  
     
     
         31 . An expression vector comprising a polynucleotide comprising: 
 (a) a fusion protein coding region comprising: 
 (i) a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src ;  
 (ii) a fluorescent protein;  
 (iii) a linker inserted between, and covalently bound to, said membrane targeting sequence of said fluorescent protein; and  
   (b) a promoter operatively linked to said fusion protein coding region.    
     
     
         32 . The expression vector of  claim 31 , wherein said expression vector is pWay20.  
     
     
         33 . The expression vector of  claim 31 , wherein said promoter is a cytomegalovirus (CMV) promoter.  
     
     
         34 . The expression vector of  claim 31 , wherein the fluorescent protein is green fluorescent protein, yellow fluorescent protein or cyan fluorescent protein.  
     
     
         35 - 70 . (canceled)