Vascular therapeutics

Abstract

The present invention provides a method of preventing or reducing restenosis, neointima formation, graft failure, atherosclerosis, angiogenesis and/or solid tumour growth in a subject. The method comprises administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun. It is preferred that the nucleic acid is a DNAzyme that targets c-Jun mRNA.

1 . A method of preventing or reducing angiogenesis and/or neovascularisation in a subject, the method comprising administering to the subject a prophylactically effective dose of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun.  
     
     
         2 . A method according to  claim 1  wherein the angiogenesis is ocular angiogenesis.  
     
     
         3 . A method according to  claim 1  wherein the subject is suffering from a condition selected from the group consisting of trachoma, retinopathy of prematurity, diabetic retinopathy, neovascular glaucoma and age-related macular degeneration  
     
     
         4 . A method according to  claim 3  wherein the condition is age-related macular degeneration.  
     
     
         5 . A method according to  claim 1  wherein the nucleic acid is selected from the group consisting of a DNAzyme targeted against c-Jun, a c-Jun antisense oligonucleotide, a ribozyme targeted against c-Jun, and a ssDNA targeted against c-Jun dsDNA such that the ssDNA forms a triplex with the c-Jun dsDNA.  
     
     
         6 . A method according to  claim 1  wherein the nucleic acid is dsRNA targeted against c-Jun mRNA, a nucleic acid molecule which results in production of dsRNA targeted against c-Jun mRNA or small interfering RNA molecules targeted against c-Jun mRNA.  
     
     
         7 . A method according to  claim 1  wherein the method is achieved by cleavage of c-Jun mRNA by a sequence-specific DNAzyme.  
     
     
         8 . A method according to  claim 7  wherein the DNAzyme comprises: 
 (i) a catalytic domain which cleaves mRNA at a purine:pyrimidine cleavage site;    (ii) first binding domain contiguous with the 5 ′ end of the catalytic domain; and    (iii) a second binding domain contiguous with the 3′ end of the catalytic domain;    wherein the binding domains are sufficiently complementary to two regions immediately flanking a purine:pyrimidine cleavage site within the c-Jun mRNA such that the DNAzyme cleaves the c-Jun mRNA.    
     
     
         9 . A method according to  claim 8  wherein the binding domains have a length of at least 6 nucleotides.  
     
     
         10 . A method according to  claim 8  wherein both binding domains have a combined total length of at least 14 nucleotides.  
     
     
         11 . A method according to  claim 8  wherein the binding domain lengths are 9 nucleotides.  
     
     
         12 . A method according to  claim 8  wherein the catalytic domain has a nucleotide sequence GGCTAGCTACAACGA.  
     
     
         13 . A method according to  claim 8  wherein the cleavage site is within the region of residues A287 to A1501 of the c-Jun mRNA.  
     
     
         14 . A method according to  claim 8  wherein the cleavage site is within the region of residues U1296 to G1497 of the c-Jun mRNA.  
     
     
         15 . A method according to  claim 14  wherein the cleavage site is the GU site corresponding to nucleotides 1311-1312.  
     
     
         16 . A method according to  claim 7  wherein the DNAzyme has the sequence 5′-cgggaggaaGGCTAGCTACAACGAgaggcgttg-3′.  
     
     
         17 . A method according to  claim 7  wherein the DNAzyme incorporates a 3′-3′ inversion at one or more termini.  
     
     
         18 . A method according to  claim 5  wherein the c-Jun antisense oligonucleotide comprises a sequence which hybridises to c-Jun within the region of residues U1296 to G1497.  
     
     
         19 . A method according to  claim 18  wherein the antisense oligonucleotide has the sequence CGGGAGGAACGAGGCGTTG.  
     
     
         20 . A method according to  claim 5  wherein the ribozyme cleaves the c-Jun mRNA in the region of residues A287 to A1501.  
     
     
         21 . A method according to  claim 20  wherein the ribozyme cleaves the c-Jun mRNA in the region of residues U1296 to G1497.  
     
     
         22 . A method according to  claim 6  wherein the dsRNA targets c-Jun mRNA in the region of residues A287 to A1501.  
     
     
         23 . A method according to  claim 22  wherein the dsRNA targets c-Jun mRNA in the region of residues U1296 to G1497.  
     
     
         24 . A method according to  claim 6  wherein the small interfering RNA molecule targeted against c-Jun mRNA has the sequence 5′-r(AACAGCUUCCUGCCUUUGUAA)dTT3′.