US2005182017A1PendingUtilityA1

Immunostimulatory nucleic acid molecules

Assignee: UNIV IOWA RES FOUNDPriority: Oct 30, 1997Filed: Mar 3, 2005Published: Aug 18, 2005
Est. expiryOct 30, 2017(expired)· nominal 20-yr term from priority
Inventors:Arthur M. Krieg
A61P 37/04A61P 31/00A61P 37/06A61P 43/00A61P 35/00A61P 31/04A61P 31/12A61P 37/02A61P 33/00A61P 37/08C12N 2310/315C12N 2310/17C07H 21/00A61K 31/711A61P 1/02A61K 31/7125A61P 1/04C12Q 1/68A61K 31/00A61P 17/06A61K 2039/55561A61K 31/7048A61P 19/02A61P 11/06A61P 1/00A61K 39/39C12N 15/117A61K 31/4706C07H 21/04A61K 39/00
57
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful as a synthetic adjuvant.

Claims

exact text as granted — not AI-modified
1 - 41 . (canceled)  
     
     
         42 . An oligonucleotide comprising TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 46).  
     
     
         43 . The oligonucleotide of  claim 42 , wherein at least one nucleotide has a phosphate backbone modification.  
     
     
         44 . The oligonucleotide of  claim 42 , wherein the oligonucleotide has less than or equal to 100 nucleotides.  
     
     
         45 . The oligonucleotide of  claim 42 , wherein the oligonucleotide has a sequence consisting of TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID No. 46).  
     
     
         46 . The oligonucleotide of  claim 43 , wherein the phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.  
     
     
         47 . A method for stimulating an immune response, comprising administering to a subject the oligonucleotide of  claim 42  in an effective amount to stimulate an immune response.  
     
     
         48 . The method of  claim 47 , wherein the subject has or is at risk of developing cancer.  
     
     
         49 . The method of  claim 47 , wherein the subject has or is at risk of developing infectious disease.  
     
     
         50 . A method for stimulating an immune response, comprising administering to a subject the oligonucleotide of  claim 45  in an effective amount to stimulate an immune response.  
     
     
         51 . The method of  claim 50 , wherein the subject has or is at risk of developing cancer.  
     
     
         52 . The method of  claim 50 , wherein the subject has or is at risk of developing infectious disease.

Join the waitlist — get patent alerts

Track US2005182017A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.