US2005070491A1PendingUtilityA1
Immunostimulatory nucleic acid molecules
Est. expiryJul 15, 2014(expired)· nominal 20-yr term from priority
A61P 31/10A61P 35/00A61P 37/06A61P 7/00A61P 43/00A61P 33/00A61P 37/08A61P 31/12A61P 31/04A61P 37/04A61P 31/00A61P 37/02A61P 1/16A61P 17/06A61P 19/02A61P 1/02A61P 17/00A61P 11/06A61P 1/04A61P 1/00A61K 31/00C07H 21/00C12N 15/117A61K 31/711A61K 31/7125C12Q 1/68C12N 2310/17A61K 2039/55561A61K 31/7048A61K 39/39A61K 31/4706C12N 2310/315A61K 39/00Y02A50/30
61
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
Claims
exact text as granted — not AI-modified1 . A method for treating an atopic condition, comprising
administering to a subject in need of treatment of an atopic condition an immunostimulatory nucleic acid, comprising: 5 ′ X 1 CGX 2 3′ wherein the immunostimulatory nucleic acid includes at least 8 nucleotides and wherein c is unmethylated and wherein X 1 and X 2 are nucleotides, in an effective amount to treat the atopic condition.
2 . The method of claim 1 , wherein the atopic condition is atopic dermatitis.
3 . The method of claim 1 , wherein X 1 is selected from the group consisting of A, G, and T, and wherein X 2 is selected from the group consisting of C and T.
4 . The method of claim 1 , further comprising administering to the subject an allergen in conjunction with the administering of the immunostimulatory nucleic acid.
5 . The method of claim 1 , wherein the immunostimulatory nucleic acid comprises
5 ′ X 1 X 2 CGX 3 X 4 3′
wherein C is unmethylated and wherein X 1 , X 2 , X 3 , and X 4 are nucleotides.
6 . The method of claim 5 , wherein X 1 X 2 is selected from the group consisting of GpT, GpG, GpA and ApA.
7 . The method of claim 5 , wherein X 3 X 4 is selected from the group consisting of TpT and CpT.
8 . The method of claim 5 , wherein X 1 X 2 is selected from the group consisting of GpT, GpG, GpA and ApA and wherein X 3 X 4 is selected from the group consisting of TpT and CpT.
9 . The method of claim 5 , wherein 5′ X 1 X 2 CGX 3 X 4 3′ is not a palindrome.
10 . The method of claim 5 , wherein the immunostimulatory nucleic acid comprises a sequence selected from the group consisting of
TCCATGTCGGTCCTGATGCT,
(SEQ ID NO:37)
TCCATGCCGGTCCTGATGCT,
(SEQ ID NO:38)
TCCATGGCGGTCCTGATGCT,
(SEQ ID NO:39)
TCCATGACGGTCCTGATGCT,
(SEQ ID NO:40)
TCCATGTCGCTCCTGATGCT,
(SEQ ID NO:42)
TCCATGTCGTTCCTGATGCT,
(SEQ ID NO:43)
TCCATGACGTTCCTGATGCT,
(SEQ ID NO:44)
and
TCCATAACGTTCCTGATGCT.
(SEQ ID NO:45)
11 . The method of claim 1 , wherein the immunostimulatory nucleic acid is a synthetic nucleic acid molecule.
12 . The method of claim 1 , wherein the immunostimulatory nucleic acid is 8 to 100 nucleotides in length.
13 . The method of claim 1 , wherein the immunostimulatory nucleic acid is 8 to 40 nucleotides in length.
14 . The method of claim 1 , wherein the immunostimulatory nucleic acid is a stabilized nucleic acid molecule.
15 . The method of claim 14 , wherein the immunostimulatory nucleic acid includes a phosphate backbone modification which is a phosphorothioate or phosphorodithioate modification.
16 . The method of claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject orally.
17 . The method of claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject transdermally.
18 . The method of claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject by injection.
19 . A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to treat or ameliorate an infection with a Mycobacterium bacterium, thereby treating the infection in the subject.
20 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule is an immunostimulatory oligodeoxyribonucleotide.
21 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule is purified bacterial DNA.
22 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule is a plasmid DNA including sufficient immunostimulatory motifs to be immunostimulatory.
23 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule is a plasmid DNA which after being administered to the subject is degraded into oligonucleotides.
24 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′pyrimidines.
25 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′ GpT dinucleotide and two 3′ pyrimidines.
26 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, and X 1 , X 2 , X 3 and X 4 are nucleotides.
27 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 and X 4 are nucleotides.
28 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 and X 2 are nucleotides, and X 3 X 4 is selected from TpT, CpT, and GpT.
29 . The method of claim 19 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 X 4 is selected from TpT, CpT, and GpT.
30 . The method of claim 19 , wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
31 . The method of claim 84 , wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
32 . The method of claim 19 , wherein said administering boosts the subject's immune response to eliminate an infection with a species of Mycobacteria.
33 . The method of claim 19 , wherein the bacterium is Mycobacterium tuberculosis.
34 . The method of claim 19 , wherein the bacterium is Mycobacterium avium.
35 . The method of claim 19 , wherein the subject has an immune system deficiency.
36 . The method of claim 35 , wherein the subject's immune system is not functioning in a normal capacity.
37 . A method for stimulating in a subject an immune response against a Mycobacterium bacterium , the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to stimulate an immune response in the subject, wherein said administering results in an immune response effective to treat, prevent or ameliorate an infection in the subject, wherein the infection is a bacterial infection with a Mycobacterium bacterium.
38 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines.
39 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′ GpT dinucleotide and two 3′ pyrimidines.
40 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, and X 1 , X 2 , X 3 and X 4 are nucleotides.
41 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 and X 4 are nucleotides.
42 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 and X 2 are nucleotides, and X 3 X 4 is selected from TpT, CpT, and GpT.
43 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 X 4 is selected from TpT, CpT, and GpT.
44 . The method of claim 90 , wherein the immunostimulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
45 . The method of claim 44 , wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
46 . The method of claim 90 , wherein the bacterium is Mycobacterium tuberculosis.
47 . The method of claim 90 , wherein the bacterium is Mycobacterium avium.
48 . The method of claim 90 , wherein the subject has an immune system deficiency.
49 . The method of claim 48 , wherein the subject's immune system is not functioning in a normal capacity.
50 . A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to treat, prevent or ameliorate an infection in the subject, wherein the infection is a bacterial infection with a Mycobacterium bacterium , thereby treating the infection in the subject, wherein the immunostimulatory nucleic acid comprises an immunostimulatory sequence comprising an unmethylated cytosine, guanine dinucleotide sequence.
51 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule is an immunostimulatory oligodeoxyribonucleotide.
52 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule is purified bacterial DNA.
53 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule is a plasmid DNA including sufficient immunostimulatory motifs to be immunostimulatory.
54 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule is a plasmid DNA which after administration to the subject is degraded into oligonucleotides.
55 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines.
56 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′ GpT dinucleotide and two 3′ pyrimidines.
57 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, and X 1 , X 2 , X 3 and X 4 are nucleotides.
58 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 and X 4 are nucleotides.
59 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5′ X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 and X 2 are nucleotides, and X 3 X 4 is selected from TpT, CpT, and GpT.
60 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 X 4 is selected from TpT, CpT, and GpT.
61 . The method of claim 50 , wherein the immunostimulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
62 . The method of claim 61 , wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
63 . The method of claim 50 , wherein said administering boosts the subject's immune response to eliminate an infection with a species of Mycobacteria.
64 . The method of claim 50 , wherein the bacterium is Mycobacterium tuberculosis.
65 . The method of claim 50 , wherein the bacterium is Mycobacterium avium.
66 . The method of claim 50 , wherein the subject has an immune system deficiency.
67 . The method of claim 66 , wherein the subject's immune system is not functioning in a normal capacity.
68 . A method for stimulating in a subject an immune response against a Mycobacterium bacterium , the method comprising: administering to a subject an immunostimulatory nucleic acid molecule in an amount effective to stimulate an immune response in the subject, wherein the immunostimulatory nucleic acid comprises an immunostimulatory sequence comprising an unmethylated cytosine, guanine dinucleotide sequence, wherein said administering results in an immune response effective to treat, prevent or ameliorate an infection in the subject, wherein the infection is a bacterial infection with a Mycobacterium bacterium.
69 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif composed of an unmethylated CpG flanked by two 5′ purines and two 3′ pyrimidines.
70 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif in which the CpG is flanked by a 5′GpT dinucleotide and two 3′pyrimidines.
71 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, and X 1 , X 2 , X 3 and X 4 are nucleotides.
72 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 and X 4 are nucleotides.
73 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 and X 2 are nucleotides, and X 3 X 4 is selected from TpT, CpT, and GpT.
74 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a CpG motif represented by:
5 ′X 1 X 2 CGX 3 X 4 3′ wherein C and G are unmethylated, X 1 X 2 is selected from GpT, GpG, and GpA, and X 3 X 4 is selected from TpT, CpT, and GpT.
75 . The method of claim 68 , wherein the immunostimulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
76 . The method of claim 75 , wherein the immunostimulatory nucleic acid molecule comprises the sequence AACGTT.
77 . The method of claim 68 , wherein the bacterium is Mycobacterium tuberculosis.
78 . The method of claim 68 , wherein the bacterium is Mycobacterium avium.
79 . The method of claim 68 , wherein the subject has an immune system deficiency.
80 . The method of claim 79 , wherein the subject's immune system is not functioning in a normal capacity.
81 . A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject an immunomodulatory nucleic acid molecule in an amount effective to inhibit replication of a Mycobacterium bacterium , thereby treating mycobacterial infection in the subject.
82 . The method of claim 81 , wherein the immunomodulatory nucleic acid molecule is selected from the group consisting of an immunostimulatory oligodeoxyribonucleotide (ISS—ODN); an isolated, detoxified bacterial polynucleotide; and an ISS-enriched plasmid DNA.
83 . The method of claim 81 , wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
a) 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′; b) 5′-Purine-TCG-Pyrimidine-Pyrimidine-3′; c) 5′-[TCG] n -3′, where n is any integer that is at least 1; and d) 5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
84 . The method of claim 81 , wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
85 . The method of claim 84 , wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
86 . The method of claim 81 , wherein said administering results in induction of an immune response effective against infection by a mycobacterial pathogen.
87 . The method of claim 81 , wherein the bacterium is Mycobacterium tuberculosis.
88 . The method of claim 81 , wherein the bacterium is Mycobacterium avium.
89 . The method of claim 81 , wherein the subject is immunocompromised.
90 . A method for inducing in a subject an immune response against a Mycobacterium bacterium , the method comprising: administering to a subject an amount of an immunomodulatory nucleic acid molecule in an amount effective to elicit an immune response against a Mycobacterium bacterium ; wherein said administering results in induction of an immune response effective to protect the subject against onset of disease or to decrease severity of symptoms of disease caused by infection by the Mycobacterium bacterium.
91 . The method of claim 90 , wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
a) 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′; b) 5′-Purine-TCG-Pyrimidine-Pyrimidine-3′; c) 5′-[TCG] n -3′, where n is any integer that is at least 1; and d) 5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
92 . The method of claim 90 , wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
93 . The method of claim 92 , wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
94 . The method of claim 90 , wherein the bacterium is Mycobacterium tuberculosis.
95 . The method of claim 90 , wherein the bacterium is Mycobacterium avium.
96 . The method of claim 90 , wherein the subject is immunocompromised.
97 . A method for treating a mycobacterial infection in a subject, the method comprising: administering to a subject multiple doses of an immunomodulatory nucleic acid molecule in an amount effective to inhibit replication of a Mycobacterium bacterium , thereby treating the mycobacterial infection in the subject, wherein the immunomodulatory nucleic acid comprises an immunostimulatory sequence comprising 5′CpG3′.
98 . The method of claim 97 , wherein the immunomodulatory nucleic acid molecule is selected from the group consisting of an immunostimulatory oligodeoxyribonucleotide (ISS—ODN); an isolated, detoxified bacterial polynucleotide; and an ISS-enriched plasmid DNA.
99 . The method of claim 97 , wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
5′-Purine-Purine-C-G-Pyrimidine-Pyrimidine-3′; 5′-Purine-TCG-Pyrimidine-Pyrimidine-3′; 5′-(TCG) n -3′, where n is any integer that is at least 1; and 5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
100 . The method of claim 97 , wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
101 . The method of claim 100 , wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
102 . The method of claim 97 , wherein said administering results in induction of an immune response effective against infection by a mycobacterial pathogen.
103 . The method of claim 97 , wherein the bacterium is Mycobacterium tuberculosis.
104 . The method of claim 97 , wherein the bacterium is Mycobacterium avium.
105 . The method of claim 97 , wherein the subject is immunocompromised.
106 . A method for inducing in a subject an immune response against a Mycobacterium bacterium , the method comprising: administering to a subject multiple doses of an immunomodulatory nucleic acid molecule in an amount effective to elicit an immune response against a Mycobacterium bacterium , wherein the immunomodulatory nucleic acid comprises an immunostimulatory sequence comprising 5′CpG 3′;
wherein said administering results in induction of an immune response effective to protect the subject against onset of disease or to decrease severity of symptoms of disease caused by infection by the Mycobacterium bacterium.
107 . The method of claim 106 , wherein the immunomodulatory nucleic acid molecule comprises a CpG motif selected from the group consisting of:
5′-Purine-Purine-C-G-Pyrimidine-Pyrimidine-3′; 5′-Purine-TCG-Pyrimidine-Pyrimidine-3′; 5′-(TCG) n -3′, where n is any integer that is at least 1; and 5′-Purine-Purine-CG-Pyrimidine-Pyrimidine-CG-3′.
108 . The method of claim 106 , wherein the immunomodulatory nucleic acid molecule comprises a sequence selected from the group consisting of: AACGCC, AACGCT, AACGTC, AACGTT, AGCGCC, AGCGCT, AGCGTC, AGCGTT, GACGCC, GACGCT, GACGTC, GACGTT, GGCGCC, GGCGCT, GGCGTC, GGCGTT, ATCGCC, ATCGCT, ATCGTC, ATCGTT, GTCGCC, GTCGCT, GTCGTC, GTCGTT, and AACGCTCG.
109 . The method of claim 108 , wherein the immunomodulatory nucleic acid molecule comprises the sequence AACGTT.
110 . The method of claim 106 , wherein the bacterium is Mycobacterium tuberculosis.
111 . The method of claim 106 , wherein the bacterium is Mycobacterium avium.
112 . The method of claim 106 , wherein the subject is immunocompromised.Join the waitlist — get patent alerts
Track US2005070491A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.