US2004241854A1PendingUtilityA1
siRNA-mediated gene silencing
Priority: Aug 5, 2002Filed: Dec 16, 2003Published: Dec 2, 2004
Est. expiryAug 5, 2022(expired)· nominal 20-yr term from priority
C12N 2310/111C12N 2310/14C12N 15/111C12N 2330/30A01K 2217/05C12N 2799/021Y02A50/30A61K 48/00C12N 2799/022C12N 2310/53C12N 15/1137C12Y 302/01031A61K 38/00C12N 15/113
61
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
The present invention is directed to small interfering RNA molecules (siRNA) targeted against an allele of interest, and methods of using these siRNA molecules.
Claims
exact text as granted — not AI-modifiedWhat is claimed is:
1 . A mammalian cell comprising
an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the cell.
2 . The mammalian cell of claim 1 , wherein the duplex is between 15 and 25 base pairs in length.
3 . The mammalian cell of claim 1 , wherein the duplex is 20 base pairs in length.
4 . The mammalian cell of claim 1 , wherein the first strand is 20 nucleotides in length, and the second strand is 20 nucleotides in length.
5 . The mammalian cell of claim 4 , wherein the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
6 . The mammalian cell of claim 5 , wherein the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5′ end of the first strand of RNA.
7 . The mammalian cell of claim 5 , wherein the one non-complementary nucleotide is at position 10, as measured from the 5′ end of the first strand of RNA.
8 . The mammalian cell of claim 4 , wherein the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to two nucleotides of the targeted gene.
9 . The mammalian cell of claim 8 , wherein two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5′ end of the first strand of RNA.
10 . The mammalian cell of claim 5 , wherein the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5′ end of the first strand of RNA.
11 . The mammalian cell of claim 1 , wherein the 5′ end of the second strand of RNA is operably linked to a G nucleotide.
12 . The mammalian cell of claim 1 , wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
13 . The mammalian cell of claim 12 , wherein the loop structure contains from 4 to 10 nucleotides.
14 . The mammalian cell of claim 13 , wherein the loop structure contains 4, 5 or 6 nucleotides.
15 . The mammalian cell of claim 1 , wherein the targeted gene is a gene associated with a condition amenable to siRNA therapy.
16 . The mammalian cell of claim 15 , wherein the gene encodes a transcript for Swedish double amyloid precursor protein (APPsw) mutation or a transcript for Tau.
17 . A mammalian cell comprising an expression cassette encoding an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first strand of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, and wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the cell.
18 . The mammalian cell of claim 17 , wherein the expression cassette is contained in a vector.
19 . The mammalian cell of claim 18 , wherein the vector is an adenoviral, lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or murine Maloney-based viral vector.
20 . The mammalian cell of claim 18 , wherein the vector is an adenoviral vector.
21 . An isolated RNA duplex comprising a first strand of RNA having a 5′ end and a 3′ end, and a second strand of RNA, wherein the first strand comprises 20 nucleotides complementary to mutant Tau transcript encoded by siA10 GGTGGCCAGATGGAAGTAAA (SEQ ID NO:63), wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and wherein the second strand is complementary to all the nucleotides of the first strand.
22 . The RNA duplex of claim 21 , wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
23 . The RNA duplex of claim 21 , wherein the loop structure contains from 4 to 10 nucleotides.
24 . The RNA duplex of claim 21 , wherein the loop structure contains 4, 5 or 6 nucleotides.
25 . An expression cassette comprising a nucleic acid encoding at least one strand of the RNA duplex of claims 21 .
26 . A vector comprising the expression cassette of claim 25 .
27 . A vector comprising two expression cassettes, a first expression cassette comprising a nucleic acid encoding the first strand of the RNA duplex of claim 21 and a second expression cassette comprising a nucleic acid encoding the second strand of the RNA duplex of claim 21 .
28 . A cell comprising the expression cassette of claim 25 .
29 . The cell of claim 28 , wherein the cell is a mammalian cell.
30 . A non-human mammal comprising the expression cassette of claim 25 .
31 . An isolated RNA duplex comprising a first strand of RNA having a 5′ end and a 3′ end, and a second strand of RNA, wherein the first strand comprises 20 nucleotides complementary to Swedish double amyloid precursor protein (APPsw) mutation transcript encoded by siT10/C11 TGAAGTGAATCTGGATGCAG (SEQ ID NO:64), wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and wherein the second strand is complementary to all the nucleotides of the first strand.
32 . The RNA duplex of claim 31 , wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
33 . The RNA duplex of claim 31 , wherein the loop structure contains from 4 to 10 nucleotides.
34 . The RNA duplex of claim 31 , wherein the loop structure contains 4, 5 or 6 nucleotides.
35 . An expression cassette comprising a nucleic acid encoding at least one strand of the RNA duplex of claims 22 .
36 . A vector comprising the expression cassette of claim 35 .
37 . A vector comprising two expression cassettes, a first expression cassette comprising a nucleic acid encoding the first strand of the RNA duplex of claim 31 and a second expression cassette comprising a nucleic acid encoding the second strand of the RNA duplex of claim 31 .
38 . A cell comprising the expression cassette of claim 26 .
39 . The cell of claim 38 , wherein the cell is a mammalian cell.
40 . A method of performing allele-specific gene silencing in a mammal comprising administering to the mammal an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the mammal.
41 . The method of claim 40 , wherein the duplex is between 15 and 25 base pairs in length.
42 . The method of claim 40 , wherein the duplex is 20 base pairs in length.
43 . The method of claim 40 , wherein the first strand is 20 nucleotides in length, and the second strand is 20 nucleotides in length.
44 . The method of claim 43 , wherein the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
45 . The method of claim 44 , wherein the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5′ end of the first strand of RNA.
46 . The method of claim 44 , wherein the one non-complementary nucleotide is at position 10, as measured from the 5′ end of the first strand of RNA.
47 . The method of claim 43 , wherein the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to two nucleotides of the targeted gene.
48 . The method of claim 47 , wherein two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5′ end of the first strand of RNA.
49 . The method of claim 44 , wherein the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5′ end of the first strand of RNA.
50 . The method of claim 40 , wherein the 5′ end of the second strand of RNA is operably linked to a G nucleotide.
51 . The method of claim 40 , wherein the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
52 . The method of claim 51 , wherein the loop structure contains from 4 to 10 nucleotides.
53 . The method of claim 52 , wherein the loop structure contains 4, 5 or 6 nucleotides.
54 . The method of claim 40 , wherein the targeted gene is a gene associated with a condition amenable to siRNA therapy.
55 . The method of claim 54 , wherein the gene encodes a transcript for Swedish double amyloid precursor protein (APPsw) mutation or a transcript for Tau.
56 . A method of producing an RNA comprising
(a) producing an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5′ end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, (b) producing an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, and (c) contacting the first strand and the second strand under hybridizing conditions to form a siRNA duplex, wherein the siRNA silences only one allele of the targeted gene in the cell.
57 . The method of claim 56 , wherein the duplex is between 15 and 25 base pairs in length.
58 . The method of claim 56 , wherein the duplex is 20 base pairs in length.
59 . The method of claim 56 , wherein the first strand is 20 nucleotides in length, and the second strand is 20 nucleotides in length.
60 . The method of claim 59 , wherein the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
61 . The method of claim 60 , wherein the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5′ end of the first strand of RNA.
62 . The method of claim 60 , wherein the one non-complementary nucleotide is at position 10, as measured from the 5′ end of the first strand of RNA.
63 . The method of claim 59 , wherein the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
64 . The method of claim 63 , wherein the two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5′ end of the first strand of RNA.
65 . The method of claim 63 , wherein the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5′ end of the first strand of RNA.
66 . The method of claim 63 , wherein the 5′ end of the second strand of RNA is operably linked to a G nucleotide.Join the waitlist — get patent alerts
Track US2004241854A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.