US2004152121A1PendingUtilityA1

Method for detecting disease-associated mutations

Priority: Dec 11, 1992Filed: Feb 27, 2004Published: Aug 5, 2004
Est. expiryDec 11, 2012(expired)· nominal 20-yr term from priority
C12Q 1/6883G01N 2800/325C12Q 2600/156C12Q 2600/118
63
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A method is described for diagnosing individuals as having hypertrophic cardiomyopathy, e.g. familial or sporadic hypertrophic cardiomyopathy. The method provides a useful diagnostic tool which becomes particularly important when testing asymptomatic individuals suspected of having the disease. Symptomatic individuals have a much better chance of being diagnosed properly by a physician. Asymptomatic individuals from families having a history of familial hypertrophic cardiomyopathy may be selectively screened using the method of this invention allowing for a diagnosis prior to the appearance of any symptoms. Individuals having the mutation responsible for the disease may be counseled to take steps which hopefully would prolong their life, i.e. avoid rigorous exercise. The methodology used in the above method also has broad applicability and may be used to detect other disease-associated mutations in DNA obtained from subject being tested for other disease-associated mutations.

Claims

exact text as granted — not AI-modified
We claim:  
     
         1 . A method for detecting the presence or absence of a mutation associated with hypertrophic cardiomyopathy for facilitating the diagnosis of hypertrophic cardiomyopathy, comprising: 
 amplifying β cardiac myosin heavy-chain DNA forming an amplified product; and    detecting the presence or absence of a mutation associated with hypertrophic cardiomyopathy in the amplified product thereby facilitating the diagnosis of hypertrophic cardiomyopathy.    
     
     
         2 . The method of  claim 1  wherein the hypertrophic cardiomyopathy is familial hypertrophic cardiomyopathy, or sporadic hypertrophic cardiomyopathy.  
     
     
         3 . The method of  claim 2  wherein the mutation associated with hypertrophic cardiomyopathy is a point mutation or a missense mutation.  
     
     
         4 . The method of  claim 1  wherein the mutation associated with hypertrophic cardiomyopathy is of a size less than the amplified product.  
     
     
         5 . The method of  claim 1  wherein the β cardiac myosin heavy-chain DNA is cDNA reverse transcribed from RNA.  
     
     
         6 . The method of  claim 5  wherein the RNA is obtained from nucleated blood cells.  
     
     
         7 . The method of  claim 1  wherein the presence or absence of the mutation associated with hypertrophic cardiomyopathy is detected by combining the amplified product with an RNA probe completely hybridizable to normal β cardiac myosin heavy-chain DNA forming a hybrid double strand having an RNA and DNA strand, the hybrid double strand having an unhybridized portion of the RNA strand at any portion corresponding to a hypertrophic cardiomyopathy associated mutation in the DNA strand; and 
 detecting the presence or absence of an unhybridized portion of the RNA strand as an indication of the presence or absence of a hypertrophic cardiomyopathy associated mutation in the corresponding portion of the DNA strand.  
 
     
     
         8 . The method of  claim 2  wherein the presence or absence of the mutation associated with familial hypertrophic cardiomyopathy is detected by combining the amplified product with an RNA probe completely hybridizable to normal β cardiac myosin heavy-chain DNA forming a hybrid double strand having an RNA and DNA strand, the hybrid double strand having an unhybridized ribonucleotide of the RNA strand at any portion corresponding to a familial hypertrophic cardiomyopathy associated point mutation in the DNA strand; 
 contacting the hybrid double strand with an agent capable of digesting an unhybridized portion of the RNA strand; and  
 detecting the presence or absence of an unhybridized ribonucleotide of the RNA strand as an indication of the presence or absence of a familial hypertrophic cardiomyopathy associated point mutation in the corresponding deoxyribonucleotide of the DNA strand.  
 
     
     
         9 . The method of  claim 1  wherein the β cardiac myosin heavy-chain DNA is amplified using a polymerase chain reaction.  
     
     
         10 . The method of  claim 9  wherein the polymerase chain reaction is performed with nested primers.  
     
     
         11 . The method of  claim 1  wherein said hypertrophic cardiomyopathy-associated mutations are selected from the group consisting of G832A; C1443T; G1836C; G1902A; G2856A; and G2931A.  
     
     
         12 . A method according to  claim 1  further comprising detecting the presence of more than one target sequence in said DNA.  
     
     
         13 . A method according to  claim 12  wherein said more than one target sequence is a hypertrophic cardiomyopathy-associated mutation selected from the group consisting of G832A; G1294A; C1443T; G1836C; G1902A; G2856A; and G2931A.  
     
     
         14 . A method of  claim 1 , wherein the β cardiac myosin heavy-chain RNA is obtained from a from said sample a cell sample from a subject being tested for hypertrophic cardiomyopathy; and 
 diagnosing the subject for hypertrophic cardiomyopathy by detecting the presence or absence of a familial hypertrophic cardiomyopathy-associated mutation in the RNA as an indication of hypertrophic cardiomyopathy.  
 
     
     
         15 . A method of  claim 14 , wherein the method for diagnosing hypertrophic cardiomyopathy is non-invasive.  
     
     
         16 . A set of DNA oligonucleotide primers for amplifying β-cardiac myosin heavy-chain DNA comprising, at least two oligonucleotides which amplify β-cardiac myosin heavy-chain DNA, said set of oligonucleotide primers being useful for facilitating the diagnosis of hypertrophic cardiomyopathy by being capable of detecting a hypertrophic cardiomyopathy-associated mutation.  
     
     
         17 . The set of primers of  claim 16  having at least four oligonucleotides.  
     
     
         18 . The oligonucleotide primers for amplifying β-cardiac myosin heavy-chain DNA of  claim 16 , said primers comprising at least two oligonucleotides wherein each of the oligonucleotides is selected from the group consisting of:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ CAAGGATCGCTACGGCTCCTGGAT 3′, 
                   (SEQ ID NO: 1) 
                     
                 
                     
                     
                 
                     
                   5′ GCGGATCCAGGTAGGCAGACTTGTCAGCCT 3′, 
                   (SEQ ID NO: 2) 
                 
                     
                     
                 
                     
                   5′ ATGCCAACCCTGCTCTGGAGGCCT 3′, 
                   (SEQ ID NO: 3) 
                 
                     
                     
                 
                     
                   5′ CTTCATGTTTCCAAAGTGCATGAT 3′, 
                   (SEQ ID NO: 4) 
                 
                     
                     
                 
                     
                   5′ CTGGGCTTCACTTCAGAGGAGAAAA 3′, 
                   (SEQ ID NO: 5) 
                 
                     
                     
                 
                     
                   5′ GCGGTACCCCAGCAGCCCGGCCTTGAAGAA 3′, 
                   (SEQ ID NO: 6) 
                 
                     
                     
                 
                     
                   5′ GGGAATTCGCGGAGCCAGACGGCACTGAAG 3′, 
                   (SEQ ID NO: 7) 
                 
                     
                     
                 
                     
                   5′ CCCTCCTTCTTGTACTCCTCCTGCTC 3′, 
                   (SEQ ID NO: 8) 
                 
                     
                     
                 
                     
                   5′ CAACTCATCACCACTCTCTTCCATC 3′, 
                   (SEQ ID NO: 9) 
                 
                     
                     
                 
                     
                   and 
                 
                     
                     
                 
                     
                   5′ GCTGAGCCTAGCAGATTCATGGCAC 3′. 
                   (SEQ ID NO: 10) 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         19 . A kit useful for facilitating the diagnosis of hypertrophic cardiomyopathy, comprising: 
 a first container holding an RNA probe completely hybridizable to the β cardiac myosin heavy chain DNA, wherein said RNA probe is capable of detecting a hypertrophic cardiomyopathy-associated mutation;    a second container holding primers useful for amplifying β cardiac myosin heavy-chain DNA; and    instructions for using the components of the kit to detect the presence or absence of a hypertrophic cardiomyopathy-associated mutation in amplified β cardiac myosin heavy-chain DNA for facilitating the diagnosis of hypertrophic cardiomyopathy.    
     
     
         20 . A kit of  claim 19  further comprising a third container holding an agent for digesting unhybridized RNA.

Join the waitlist — get patent alerts

Track US2004152121A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.