US2004147468A1PendingUtilityA1
Immunostimulatory nucleic acid molecules
Individually held — no corporate assignee on recordPriority: Jul 15, 1994Filed: Oct 3, 2003Published: Jul 29, 2004
Est. expiryJul 15, 2014(expired)· nominal 20-yr term from priority
A61P 33/00A61P 37/02A61P 31/04A61P 37/06A61P 35/00A61P 43/00A61P 31/12A61P 31/00A61P 31/10A61P 37/08A61P 7/00A61P 37/04A61P 17/06A61P 1/00A61P 1/16A61P 1/02A61P 1/04A61P 17/00A61P 11/06A61P 19/02C12Q 1/68C07H 21/00A61K 31/00A61K 31/4706A61K 31/711A61K 39/39A61K 2039/55561A61K 31/7048C12N 2310/17A61K 31/7125C12N 15/117C12N 2310/315A61K 39/00Y02A50/30
61
PatentIndex Score
0
Cited by
0
References
0
Claims
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
Claims
exact text as granted — not AI-modified1 . A method for treating an atopic condition, comprising
administering to a subject in need of treatment of an atopic condition an immunostimulatory nucleic acid, comprising: 5′ X 1 CGX 2 3′ wherein the immunostimulatory nucleic acid includes at least 8 nucleotides and wherein c is unmethylated and wherein X 1 and X 2 are nucleotides, in an effective amount to treat the atopic condition.
2 . The method of claim 1 , wherein the atopic condition is atopic dermatitis.
3 . The method of claim 1 , wherein X 1 is selected from the group consisting of A, G, and T, and wherein X 2 is selected from the group consisting of C and T.
4 . The method of claim 1 , further comprising administering to the subject an allergen in conjunction with the administering of the immunostimulatory nucleic acid.
5 . The method of claim 1 , wherein the immunostimulatory nucleic acid comprises
5′ X 1 X 2 CGX 3 X 4 3′
wherein C is unmethylated and wherein X 1 , X 2 , X 3 , and X 4 are nucleotides.
6 . The method of claim 5 , wherein X 1 X 2 is selected from the group consisting of GpT, GpG, GpA and ApA.
7 . The method of claim 5 , wherein X 3 X 4 is selected from the group consisting of TpT and CpT.
8 . The method of claim 5 , wherein X 1 X 2 is selected from the group consisting of GpT, GpG, GpA and ApA and wherein X 3 X 4 is selected from the group consisting of TpT and CpT.
9 . The method of claim 5 , wherein 5′ X 1 X 2 CGX 3 X 4 3′ is not a palindrome.
10 . The method of claim 5 , wherein the immunostimulatory nucleic acid comprises a sequence selected from the group consisting of
TCCATGTCGGTCCTGATGCT,
(SEQ ID NO: 37)
TCCATGCCGGTCCTGATGCT,
(SEQ ID NO: 38)
TCCATGGCGGTCCTGATGCT,
(SEQ ID NO: 39)
TCCATGACGGTCCTGATGCT,
(SEQ ID NO: 40)
TCCATGTCGCTCCTGATGCT,
(SEQ ID NO: 42)
TCCATGTCGTTCCTGATGCT,
(SEQ ID NO: 43)
TCCATGACGTTCCTGATGCT,
(SEQ ID NO: 44)
and
TCCATAACGTTCCTGATGCT.
(SEQ ID NO: 45)
11 . The method of claim 1 , wherein the immunostimulatory nucleic acid is a synthetic nucleic acid molecule.
12 . The method of claim 1 , wherein the immunostimulatory nucleic acid is 8 to 100 nucleotides in length.
13 . The method of claim 1 , wherein the immunostimulatory nucleic acid is 8 to 40 nucleotides in length.
14 . The method of claim 1 , wherein the immunostimulatory nucleic acid is a stabilized nucleic acid molecule.
15 . The method of claim 14 , wherein the immunostimulatory nucleic acid includes a phosphate backbone modification which is a phosphorothioate or phosphorodithioate modification.
16 . The method of claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject orally.
17 . The method of claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject transdermally.
18 . The method of claim 1 , wherein the immunostimulatory nucleic acid is administered to the subject by injection.Join the waitlist — get patent alerts
Track US2004147468A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.