Kv6.2, a voltage-gated potassium channel subunit

Abstract

The invention provides isolated nucleic acid and amino acid sequences of Kv6.2, antibodies to Kv6.2, methods of detecting Kv6.2, methods of screening for voltage-gated potassium channel activators and inhibitors using biologically active Kv6.2, and kits for screening for activators and inhibitors of voltage gated potassium channels comprising Kv6.2.

What is claimed is:  
     
         1 . An isolated nucleic acid encoding a polypeptide monomer comprising an alpha subunit of a heteromeric potassium channel, the polypeptide monomer: 
 (i) having the ability to form, with at least one additional Kv alpha subunit, a heteromeric potassium channel having the characteristic of voltage gating;    (ii) having a monomer subunit association region that has greater than about 70% amino acid sequence identity to a Kv6.2 subunit association region; and    (iii) specifically binding to polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID NO:17.    
     
     
         2 . The isolated nucleic acid of  claim 1 , wherein the nucleic acid encodes human Kv6.2.  
     
     
         3 . The isolated nucleic acid of  claim 1 , wherein the nucleic acid encodes mouse Kv6.2.  
     
     
         4 . The isolated nucleic acid of  claim 1 , wherein the nucleic acid encodes SEQ ID NO:1 or SEQ ID NO:17.  
     
     
         5 . The isolated nucleic acid sequence of  claim 1 , wherein the nucleic acid has a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:18.  
     
     
         6 . The isolated nucleic acid of  claim 1 , wherein the nucleic acid is amplified by primers that selectively hybridize under stringent hybridization conditions to the same sequence as the primer sets selected from the group consisting of:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   ATGCCCATGTCTTCCAGAGACAGG, 
                   (SEQ ID NO:3) 
                     
                 
                     
                     
                 
                     
                   GATGTCTAGAGGGAGTTACATGTAGCG 
                   (SEQ ID NO:4) 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   GGCACTACGCATCCTCTACGTAATGCGC, 
                   (SEQ ID NO:5) 
                 
                     
                     
                 
                     
                   GATGATGGCCCACCAATAGGATGCGG 
                   (SEQ ID NO:6) 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   ATGCCCATGCCTTCCAGAGACGG, 
                   (SEQ ID NO:7) 
                 
                     
                     
                 
                     
                   TTACATGTGCATGATAGGCAAGGCTG 
                   (SEQ ID NO:8) 
                 
                     
                   and 
                 
                     
                     
                 
                     
                   GTCCAGGCCCAAGACAAGTGTCAG, 
                   (SEQ ID NO:9) 
                 
                     
                     
                 
                     
                   GGGAGAAGGTGTGGAAGATAGACG. 
                   (SEQ ID NO:10) 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         7 . The isolated nucleic acid of  claim 1 , wherein the nucleic acid encodes a polypeptide monomer having a molecular weight of about between 53 kDa to about 65 kDa.  
     
     
         8 . An isolated nucleic acid encoding a polypeptide monomer comprising an alpha subunit of a heteromeric potassium channel, the polypeptide monomer: 
 (i) having the ability to form, with at least one additional Kv alpha subunit, a heteromeric potassium channel having the characteristic of voltage gating;    (ii) having an S4-S6 region that has greater than about 85% amino acid sequence identity to a Kv6.2 S4-S6 region and    (iii) specifically binding to polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID NO:17.    
     
     
         9 . An isolated nucleic acid encoding a polypeptide monomer that specifically hybridizes under stringent conditions to SEQ ID NO:2 or SEQ ID NO:18.  
     
     
         10 . The isolated nucleic acid of  claim 1  or  8 , wherein said nucleic acid selectively hybridizes under moderately stringent hybridization conditions to a nucleotide sequence of SEQ ID NO:2 or SEQ ID NO:18.  
     
     
         11 . An isolated polypeptide monomer comprising an alpha subunit of a heteromeric potassium channel, the polypeptide monomer: 
 (i) having the ability to form, with at least one additional Kv alpha subunit, a heteromeric potassium channel having the characteristic of voltage gating;    (ii) having a monomer subunit association region that has greater than 70% amino acid sequence identity to a Kv6.2 subunit association region; and    (iv) specifically binding to polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID NO:17.    
     
     
         12 . The isolated polypeptide monomer of  claim 11 , wherein the polypeptide monomer has an amino acid sequence of human Kv6.2.  
     
     
         13 . The isolated polypeptide monomer of  claim 11 , wherein the polypeptide monomer has an amino acid sequence of mouse Kv6.2.  
     
     
         14 . The isolated polypeptide monomer of  claim 11 , wherein the polypeptide monomer has an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17.  
     
     
         15 . An isolated polypeptide monomer comprising an alpha subunit of a heteromeric potassium channel, the polypeptide monomer: 
 (i) having the ability to form, with at least one additional Kv alpha subunit, a heteromeric potassium channel having the characteristic of voltage gating;    (ii) having an S4-S6 region that has greater than 85% amino acid sequence identity to a Kv6.2 S4-S6 region; and    (iii) specifically binding to polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID NO:17.    
     
     
         16 . An antibody that selectively binds to the polypeptide monomer of  claim 11  or  15 .  
     
     
         17 . An antibody of  claim 16 , wherein the polypeptide monomer has an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17.  
     
     
         18 . An expression vector comprising the nucleic acid of  claim 1 .  
     
     
         19 . A host cell transfected with the vector of  claim 18 .  
     
     
         20 . A method for identifying a compound that increases or decreases ion flux through a heteromeric voltage-gated potassium channel, the method comprising the steps of: 
 (i) contacting the compound with a eukaryotic host cell or cell membrane in which has been expressed a polypeptide monomer comprising an alpha subunit of a heteromeric potassium channel, the polypeptide monomer: 
 (a) having the ability to form, with at least one additional Kv alpha subunit, a heteromeric potassium channel having the characteristic of voltage gating;  
 (b) having a monomer subunit association region that has greater than 70% amino acid sequence identity to a Kv6.2 subunit association region; and  
 (c) specifically binding to polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID NO:17; and  
   (ii) determining the functional effect of the compound upon the cell or cell membrane expressing the potassium channel.    
     
     
         21 . The method of  claim 20 , wherein the increased or decreased flux of ions is determined by measuring changes in current or voltage.  
     
     
         22 . The method of  claim 20 , wherein the potassium channel monomer polypeptide is recombinant.  
     
     
         23 . The method of  claim 20 , wherein the potassium channel monomer polypeptide is human Kv6.2.  
     
     
         24 . The method of  claim 20 , wherein the potassium channel monomer polypeptide is mouse Kv6.2.  
     
     
         25 . The method of  claim 20 , wherein the potassium channel monomer polypeptide has an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17.  
     
     
         26 . A method for identifying a compound that increases or decreases ion flux through a heteromeric voltage-gated potassium channel, the method comprising the steps of: 
 (i) contacting the compound with a eukaryotic host cell or cell membrane in which has been expressed a polypeptide monomer comprising an alpha subunit of a heteromeric potassium channel, the polypeptide monomer: 
 (a) having the ability to form, with at least one additional Kv alpha subunit, a heteromeric potassium channel having the characteristic of voltage gating;  
 (b) having an S4-S6 region that has greater than 85% amino acid sequence identity to a Kv6.2 S4-S6 region; and  
 (c) specifically binding to polyclonal antibodies generated against SEQ ID NO:1 or SEQ ID NO:17; and  
   (ii) determining the functional effect of the compound upon the cell or cell membrane expressing the potassium channel.    
     
     
         27 . A method of detecting the presence of Kv6.2 in mammalian tissue, the method comprising the steps of: 
 (i) isolating a biological sample;    (ii) contacting the biological sample with a Kv6.2-specific reagent that selectively associates with Kv6.2; and,    (iii) detecting the level of Kv6.2-specific reagent that selectively associates with the sample.    
     
     
         28 . The method of  claim 27 , wherein the Kv6.2-specific reagent is selected from the group consisting of: Kv6.2 specific antibodies, Kv6.2 specific oligonucleotide primers, and Kv6.2 nucleic acid probes.  
     
     
         29 . The method of  claim 27 , wherein the sample is from a human.  
     
     
         30 . In a computer system, a method of screening for mutations of human Kv6.2 genes, the method comprising the steps of: 
 (i) entering into the computer a first nucleic acid sequence encoding an voltage-gated potassium channel polypeptide monomer having a nucleotide sequence of SEQ ID NO:2, SEQ ID NO:18, and conservatively modified versions thereof;    (ii) comparing the first nucleic acid sequence with a second nucleic acid sequence having substantial identity to the first nucleic acid sequence; and    (iii) identifying nucleotide differences between the first and second nucleic acid sequences.    
     
     
         31 . The method of  claim 30 , wherein the second nucleic acid sequence is associated with a disease state.  
     
     
         32 . In a computer system, a method for identifying a three-dimensional structure of Kv6.2 polypeptide monomers, the method comprising the steps of: 
 (i) entering into the computer system an amino acid sequence of at least 25 amino acids of a potassium channel polypeptide monomer or at least 75 nucleotides of a gene encoding the polypeptide monomer, the polypeptide monomer having an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:17, and conservatively modified versions thereof; and    (ii) generating a three-dimensional structure of the polypeptide monomer encoded by the amino acid sequence.    
     
     
         33 . The method of  claim 32 , wherein said amino acid sequence is a primary structure and wherein said generating step includes the steps of: 
 (i) forming a secondary structure from said primary structure using energy terms determined by the primary structure; and    (ii) forming a tertiary structure from said secondary structure using energy terms determined by said secondary structure.    
     
     
         34 . The method of  claim 33 , wherein said generating step further includes the step of forming a quaternary structure from said tertiary structure using anisotropic terms encoded by the tertiary structure.  
     
     
         35 . The method of  claim 31 , further comprising the step of identifying regions of the three-dimensional structure of a Kv6.2 potassium channel protein that bind to ligands and using the regions to identify ligands that bind to the potassium channel protein.