US2004106568A1PendingUtilityA1

Methods for treating and preventing infectious disease

Assignee: UNIV IOWA RES FOUNDPriority: Jul 15, 1994Filed: Jul 25, 2003Published: Jun 3, 2004

Est. expiryJul 15, 2014(expired)· nominal 20-yr term from priority

Inventors:Arthur M. Krieg Dennis Klinman Alfred Steinberg

A61P 33/00A61P 37/08A61P 37/04A61P 31/04A61P 37/06A61P 31/12A61P 35/00A61P 43/00A61P 37/02A61K 31/7125A61P 11/06C07H 21/00A61P 1/00A61K 31/711A61K 31/7048A61P 17/06C12N 2310/315A61P 1/04A61K 39/39C12Q 1/68A61K 31/4706A61K 2039/55561A61K 31/00C12N 15/117A61P 1/02C12N 2310/17A61P 19/02A61K 39/00Y02A50/30

PatentIndex Score

Cited by

References

Claims

Abstract

Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful as a synthetic adjuvant.

Claims

exact text as granted — not AI-modified

We claim:

1 . An isolated nucleic acid sequence containing at least one unmethylated CpG dinucleotide and having a formula:
5′N 1 X 1 CGX 2 N 2 3′ wherein at least one nucleotide separates consecutive CpGs; X 1 is adenine, guanine, or thymine; X 2 is cytosine or thymine; N is any nucleotide and N 1 +N 2 is from about 0-26 bases with the proviso that N 1 +N 2 does not contain a CCGG quadmer or more than one CCG or CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.

2 . The nucleic acid sequence of claim 1 , wherein X 1 is thymine

3 . The nucleic acid sequence of claim 1 , wherein X 2 is thymine.

4 . The nucleic acid sequence of claim 1 , which is GTCG (T/C) T or TGACGTT.

5 . The nucleic acid sequence of claim 1 , wherein the sequence is TGTCG (T/C) T.

6 . The nucleic acid sequence of claim 1 , which is TCCATGTCGTTCCTGTCGTT.

7 . The nucleic acid sequence of claim 1 , which is TCCTGACGTTCCTGACGTT.

8 . The nucleic acid sequence of claim 1 , which is TCGTCGTTTTGTCGTTTTGTCGTT.

9 . An isolated nucleic acid sequence containing at least one unmethylated CpG dinucleotide and having the formula:
5′NX 1 X 2 CGX 3 X 4 N 3′ wherein at least one nucleotide separates consecutive CpGs; X 1 X 2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X 3 X 4 is selected from the group consisting of TpT or CpT; N is any nucleotide and N 1 N 2 is from about 0-26 bases with the proviso that N 1 and N 2 does not contain a CCGG quadmer or more than one CCG or CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.

10 . The nucleic acid sequence of claim 9 , wherein the nucleotide that separates at least two consecutive CpGs is thymine.

11 . The nucleic acid sequence of claim 9 , wherein X 3 and X 4 are thymine.

12 . A nucleic acid sequence of any of claims 1 or 9 , wherein at least one nucleotide has a phosphate backbone modification.

13 . The nucleic acid sequence of claim 12 , wherein the phosphate backbone modification is a phosphorothioate or phosphorodithioate modification.

14 . The nucleic acid sequence of claim 13 , wherein the phosphate backbone modification occurs at the 5′ end of the nucleic acid.

15 . The nucleic acid sequence of claim 14 , wherein the modification occurs at the first two internucleotide linkages of the 5′ end of the nucleic acid.

16 . The nucleic acid sequence of claim 13 , wherein the phosphate backbone modification occurs at the 3′ end of the nucleic acid.

17 . The nucleic acid sequence of claim 16 , wherein the modification occurs at the last five internucleotide linkages of the 3′ end of the nucleic acid.

18 . A method of stimulating immune activation in a subject, wherein the stimulation is predominantly a Th1 pattern of immune activation, comprising administering to the subject a nucleic acid sequence having the formula of claim 1 or claim 9 .

19 . The method of claim 18 , wherein the subject is human.

20 . A method of stimulating cytokine production in a subject comprising administering to the subject a nucleic acid sequence having the formula of claim 1 or claim 9 .

21 . The method of claim 20 , wherein the cytokine is selected from the group consisting of:
L-6, IL-12, IFN-γ, TNF-α and GM-CSF.

22 . The method of claim 20 , wherein the subject is human.

23 . The method of claim 20 , where the nucleic acid sequence is selected from the group consisting of:

TCCATGTCGCTCCTGATGCT,

TCCATAACGTTCCTGATGCT,

TCCATGACGATCCTGATGCT,

TCCATGGCGGTCCTGATGCT,

TCCATGTCGGTCCTGATGCT,

TCCATAACGTCCCTGATGCT,

TCCATGTCGTTCCTGATGCT; and

TCGTCGTTTTGTCGTTTTGTCGTT.

24 . A method of stimulating NK lytic activity in a subject comprising administering to the subject a nucleic acid sequence having the formula of claim 1 or claim 9 .

25 . The method of claim 24 , where the subject is human.

26 . The method of claim 24 , where the nucleic acid sequence is selected from the group consisting of:

TCGTCGTTGTCGTTGTCGTT,

TCCATGACGGTCCTGATGCT,

TCCATGACGATCCTGATGCT,

TCCATGACGCTCCTGATGCT,

TCCATGACGTTCCTGATGCT,

TCCATAACGTTCCTGATGCT,

TCCATCACGTGCCTGATGCT,

GGGGTCAACGTTGAGGGGGG,

TCGTCGTTTTGTCGTTTTGTCGTT,

TCGTCGTTGTCGTTTTGTCGTT,

GCGTGCGTTGTCGTTGTCGTT,

TGTCGTTTGTCGTTTGTCGTT,

TGTCGTTGTCGTTGTCGTT; and

TCGTCGTCGTCGTT.

27 . A method of stimulating B cell proliferation in a subject, comprising administering to the subject a nucleic acid sequence having the formula of claim 1 or claim 9 .

28 . The method of claim 27 , where the subject is human.

29 . The method of claim 27 , where the nucleic acid sequence is selected from the group consisting of:

TCCTGTCGTTCCTTGTCGTT),

TCCTGTCGTTTTTTGTCGTT,

TCGTCGCTGTCTGCCCTTCTT,

TCGTCGCTGTTGTCGTTTCTT,

TCGTCGTTTTGTCGTTTTGTCGTT,

TCGTCGTTGTCGTTTTGTCGTT; and

TGTCGTTGTCGTTGTCGTT.

30 . A method of stimulating immune activation in a subject comprising administering to a subject an nucleic acid sequence having the formula of claim 1 , wherein the nucleic acid sequence acts as an adjuvant.

31 . The method of claim 30 , where the subject is a mammal.

32 . The method of claim 30 , where the nucleic acid sequence is selected from the group consisting of:

TCCATGACGTTCCTGACGTT,

GTCG (T/C) T; and

TGTCG (T/C) T.

33 . A method for treating a subject having an asthmatic disorder by administering to the subject an nucleic acid sequence in a pharmaceutically acceptable carrier having the formula of claim 1 .

34 . The method of claim 33 , where the subject is human.

35 . The method of claim 33 , where the nucleic acid sequence is

TCCATGACGTTCCTGACGTT.

36 . A method for treating a subject having an autoimmune or other CpG associated disorder by inhibiting CpG-mediated leukocyte activation comprising administering to the subject an inhibitor of endosomal acidification in a pharmaceutically acceptable carrier.

37 . The method of claim 36 , where the subject is human.

38 . The method of claim 36 , where the inhibitor is selected from the group consisting of:
bafilomycin A, chloroquine, and monensin.

39 . The method of claim 38 , where the inhibitor is administered at a dosage of the less than about 10 μM.

40 . The method of claim 36 , wherein the disorder is selected from the group consisting of systemic lupus erythematosus, sepsis, inflammatory bowel disease, psoriasis, gingivitis, arthritis, Crohn&#39;s disease, Grave&#39;s disease and asthma.

41 . The method of claim 40 , where the disorder is systemic lupus erythematosus.

Join the waitlist — get patent alerts

Track US2004106568A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.