Immunomodulatory oligonucleotides

Abstract

Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.

1 . An oligonucleotide comprising from about 2 to about 100 nucleotides and containing at least one unmethylated CpG dinucleotide.  
     
     
         2 . The oligonucleotide of  claim 1  which is represented by the following formula: 
       5′ X 1 X 2 CGX 3 X 4  3′ wherein c and g are unmethylated, X 1 , X 2 , X 3  and X4 are nucleotides and a GCG trinucleotide sequence is not present at or near the 5′ and 3′ termini.    
     
     
         3 . The oligonucleotide of  claim 2  having a phosphate backbone modification.  
     
     
         4 . The oligonucleotide of  claim 3  wherein the phosphate backbone modification is a phosphorothioate backbone modification.  
     
     
         5 . The oligonucleotide of  claim 4  comprising the following nucleotide sequence: 
       5′ GGGGTCAACGTTGAGGGGGG 3′   (SEQ ID NO:1) 
     
     
         6 . The oligonucleotide of  claim 5  having a phosphate backbone modification.  
     
     
         7 . The oligonucleotide of  claim 6  wherein the phosphate backbone modification is a phosphorothioate modification.  
     
     
         8 . An oligonucleotide delivery complex comprising the oligonucleotide of  claim 1  and a targeting means.  
     
     
         9 . An oligonucleotide delivery complex of  claim 8 , wherein the targeting means is selected from the group consisting of cholesterol, virosome, liposome, lipid, a target cell specific binding agent  
     
     
         10 . A pharmaceutical composition comprising the oligonucleotide of  claim 9  and a pharmaceutically acceptable carrier.  
     
     
         11 . A pharmaceutical composition comprising the oligonucleotide of  claim 2  and a pharmaceutically acceptable carrier.  
     
     
         12 . A method for activating a subject's B cells comprising contacting the B cells with an effective amount of the oligonucleotide of  claim 1 .  
     
     
         13 . A method for activating a subject's B cells comprising contacting the B cells with an effective amount of the oligonucleotide of  claim 2 .  
     
     
         14 . A method for activating a subject's natural killer cells comprising contacting the natural killer cells with an effective amount of the oligonucleotide of  claim 1 .  
     
     
         15 . A method for activating a subject's natural killer cells comprising contacting the natural killer cells with an effective amount of the oligonucleotide of  claim 2 .  
     
     
         16 . A method for treating, preventing or ameliorating an immune system deficiency in a subject comprising administering to the subject an effective amount of a pharmaceutical composition of  claim 10 .  
     
     
         17 . A method for treating, preventing or ameliorating an immune system deficiency in a subject comprising the steps of: 
 a) contacting lymphocytes obtained from the subject with a composition of  claim 1  ex vivo, thereby producing activated lymphocytes; and    b) readministering the activated lymphocytes obtained in step a) to the subject.    
     
     
         18 . A method for vaccinating a subject comprising administering to the subject a composition of  claim 10  in conjunction with administration of a vaccine.  
     
     
         19 . A method for treating a disease associated with an immune system activation in a subject comprising administering to the subject an effective amount of a neutral oligonucleotide alone or in conjunction with a pharmaceutically acceptable carrier.  
     
     
         20 . A method of  claim 19  wherein the disease associated with immune system activation is systemic lupus erythematosus.  
     
     
         30 . A method of  claim 19  wherein the disease associated with immune system activation is sepsis.  
     
     
         31 . An improved method for performing antisense therapy comprising methylating CpG containing oligonucleotides prior to administration to a subject.  
     
     
         32 . An improved method for in vivo diagnoses using oligonucleotide probes comprising methylating CpG containing oligonucleotides prior to administration to a subject  
     
     
         33 . An oligonucleotide which is capable of interfering with the activity of viral or cellular transcription factors and containing a consensus immunoinhibitory CpG motif represented by the formula: 
       5′GCGXnGCG3′ 
       wherein X=a nucleotide and n=in the range of 0-50.  
     
     
         34 . An oligonucleotide of  claim 33 , wherein X is a pyrimidine.  
     
     
         35 . An oligonucleotide of  claim 34 , wherein Xn is a CpG dinucleotide  
     
     
         36 . A method for treating or preventing a viral infection in a subject comprising administering to the subject an immunoinhibitory oligonucleotide of  claim 33.