Method of collecting data for estimation of susceptibility to periodontal disease

Abstract

A method is provided, which comprises examining the regulating activity of a defensin gene promoter closely associated with the expression activity of defensin, an antibacterial peptide, on the basis of the detection of a gene mutation, and estimating future susceptibility to periodontal disease. The sequence homology between DNA derived from a defensin gene promoter existing in a sample obtained from the gingival tissues of a subject and a nucleotide sequence comprising a mutation site in the promoter region, and/or compatibility in PCR amplification, are determined. Thereby a gene mutation is detected and then the site of the gene mutation is determined, so that data for the estimation can be collected.

What is claimed is:  
     
         1 . A method of collecting data for estimating susceptibility to periodontal disease, wherein the method comprises: 
 in order to detect the presence of a gene mutation and/or a mutation site existing in the promoter region of a human defensin gene in a sample,    by using a nucleotide sequence being a part of the promoter of the defensin gene and comprising a mutation site, as a nucleotide sequence for a probe,    determining 
 (i) a hybridization site of hybridization between the defensin gene promoter nucleotide sequence in the sample and said probe, and/or  
 (ii) an amplification ability in gene amplification where primers comprising the nucleotide sequence of said probe are used;  
   thereby clarifying the change of the activity of the defensin promoter to regulate the expression of the defensin gene based on the thus detected presence of a gene mutation and/or a mutation site.    
     
     
         2 . A method of collecting data for estimating susceptibility to periodontal disease, wherein the method comprises: 
 in order to detect the presence of a gene mutation and/or a mutation site existing in the promoter region of a human β-defensin 2 gene in a sample,    by using a nucleotide sequence being a part of the promoter of the β-defensin 2 gene and comprising a mutant nucleotide, as a nucleotide sequence for a probe,    determining 
 (i) a hybridization site of hybridization between the β-defensin 2 gene promoter nucleotide sequence in the sample and said probe, and/or  
 (ii) an amplification ability in gene amplification where primers comprising the nucleotide sequence of said probe are used;  
   thereby clarifying the change of the activity of the human β-defensin 2 promoter to regulate the expression of the β-defensin 2 gene based on the thus detected presence of a gene mutation and/or a mutation site.    
     
     
         3 . A nucleotide sequence used as a probe to obtain data for estimating susceptibility to periodontal disease, wherein the nucleotide sequence is used to detect a mutant type sequence existing in the promoter region of a human β-defensin 2 gene, and comprises at least 5 nucleotides being each of upstream and downstream from a mutation site, otherwise at-least-10-nucleotide-containing sequences of which 3′ terminus is the nucleotide of a mutation site in the promoter nucleotide sequences.  
     
     
         4 . The nucleotide sequence used as a probe according to  claim 3 , wherein said nucleotide sequence is any sequence selected from: 
 a DNA nucleotide sequence amplified by primer set 1:                                          5′ ATAGGCGTAAGCCATCATGCC 3′   (SEQ ID NO:1)                       5′ CATCCTGGTTCCTCCCTCTTT 3′   (SEQ ID NO:2)                               wherein G is substituted by C at a site −1431 located upstream of the transcription initiation point of the human β-defensin 2 gene, and/or    a DNA nucleotide sequence amplified by primer set 2:                                          5′ TGTTTCTCAAACTGCCCTTAG 3′   (SEQ ID NO:3)                       5′ ATGGGATTGTGACTACATGTG 3′   (SEQ ID NO:4)                               wherein G is substituted by T at a site −1035 (mutation site 2-1), and/or A is substituted by G at a site −1027 (mutation site 2-2), and/or G is substituted by A at a site −936 (mutation site 2-3), and/or C is substituted by T at a site −923 (mutation site 2-4),    and/or a DNA nucleotide sequence amplified by the same primer set as above, wherein T is substituted by C at a site −912 (mutation site 2-5), and/or G is substituted by A at a site −874 (mutation site 2-6), and/or    a DNA nucleotide sequence amplified by primer set 3:                                          5′ TCCGGACCCACTTGAGACTCC 3′   (SEQ ID NO:5)                       5′ GAAAATTCCTCCTATCTTGCA 3′   (SEQ ID NO:6)                               wherein C is substituted by T at a site −539 (mutation site 3-1), and/or A is substituted by G at a site −472 (mutation site 3-2), and/or    a DNA nucleotide sequence amplified by primer set 4:                                          5′ ACTCCATTCACACACTGGGTT 3′   (SEQ ID NO:7)                       5′ AACGAGAAGAGGAGATACAAG 3′   (SEQ ID NO:8)                               wherein T is substituted by C at a site −108 (mutation site 4).    
     
     
         5 . The nucleotide sequence used as a probe according to  claim 3  , wherein said nucleotide sequence is further modified with markers for detection and/or amplification.  
     
     
         6 . A primer which comprises both nucleotide sequences of primer set 1:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ ATAGGCGTAAGCCATCATGCC 3′ 
                   (SEQ ID NO:1) 
                     
                 
                     
                     
                 
                     
                   5′ CATCCTGGTTCCTCCCTCTTT 3′ 
                   (SEQ ID NO:2) 
                 
                     
                     
                 
             
                
                
                
                
                
               
            
           
         
       
       and is used to amplify DNA derived from a human defensin gene.  
     
     
         7 . A primer which comprises both nucleotide sequences of primer set 2:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ TGTTTCTCAAACTGCCCTTAG 3′ 
                   (SEQ ID NO:3) 
                     
                 
                     
                     
                 
                     
                   5′ ATGGGATTGTGACTACATGTG 3′ 
                   (SEQ ID NO:4) 
                 
                     
                     
                 
             
                
                
                
                
                
               
            
           
         
       
       and is used to amplify DNA derived from a human defensin gene.  
     
     
         8 . A primer which comprises both nucleotide sequences of primer set 3:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ TCCGGACCCACTTGAGACTCC 3′ 
                   (SEQ ID NO:5) 
                     
                 
                     
                     
                 
                     
                   5′ GAAAATTCCTCCTATCTTGCA 3′ 
                   (SEQ ID NO:6) 
                 
                     
                     
                 
             
                
                
                
                
                
               
            
           
         
       
       and is used to amplify DNA derived from a human defensin gene.  
     
     
         9 . A primer which comprises both nucleotide sequences of primer set 4:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ ACTCCATTCACACACTGGGTT 3′ 
                   (SEQ ID NO:7) 
                     
                 
                     
                     
                 
                     
                   5′ AACGAGAAGAGGAGATACAAG 3′ 
                   (SEQ ID NO:8) 
                 
                     
                     
                 
             
                
                
                
                
                
               
            
           
         
       
       and is used to amplify DNA derived from a human defensin gene.  
     
     
         10 . A primer which has any one of the nucleotide sequences used as probes according to  claim 4 , and is used to determine an amplification ability in gene amplification.  
     
     
         11 . The nucleotide sequence used as a probe according to  claim 4 , wherein said nucleotide sequence is further modified with markers for detection and /or amplification.  
     
     
         12 . A kit used to estimate susceptibility to periodontal disease wherein the kit comprises at least one type of a probe comprising a nucleotide sequence to detect a mutant type sequence existing in the promoter region of a human defensin 2 gene, and optionally comprising a primer such as at least 0.5 nucleotides being each of upstream and downstream from a mutation site and otherwise at-least-10-nucleotide-containing sequences of which 3′ terminus is the nucleotide of a mutation site in the promoter nucleotide sequences, so as to detect a mutant gene existing in the promoter region of a human defensin gene.  
     
     
         13 . The kit according to  claim 12 , wherein the nucleotide sequence used as a probe is at least one sequence selected from: 
 a DNA nucleotide sequence amplified by primer set 1:                                          5′ ATAGGCGTAAGCCATCATGCC 3′   (SEQ ID NO:1)                       5′ CATCCTGGTTCCTCCCTCTTT 3′   (SEQ ID NO:2)                               wherein G is substituted by C at a site −1431 located upstream of the transcription initiation point of the human β-defensin 2 gene, and/or    a DNA nucleotide sequence amplified by primer set 2:                                          5′ TGTTTCTCAAACTGCCCTTAG 3′   (SEQ ID NO:3)                       5′ ATGGGATTGTGACTACATGTG 3′   (SEQ ID NO:4)                               wherein G is substituted by T at a site −1035 (mutation site 2-1), and/or A is substituted by G at a site-1027 (mutation site 2-2), and/or G is substituted by A at a site −936 (mutation site 2-3), and/or C is substituted by T at a site −923 (mutation site 2-4), and/or    a DNA nucleotide sequence amplified by the same primer set as above, wherein T is substituted by C at a site −912 (mutation site 2-5), and/or G is substituted by A at a site −874 (mutation site 2-6), and/or    a DNA nucleotide sequence amplified by primer set 3:                                          5′ TCCGGACCCACTTGAGACTCC 3′   (SEQ ID NO:5)                       5′ GAAAATTCCTCCTATCTTGCA 3′   (SEQ ID NO:6)                               wherein C is substituted by T at a site −539 (mutation site 3-1), and/or A is substituted by G at a site −472 (mutation site 3-2), and/or    a DNA nucleotide sequence amplified by primer set 4:                                          5′ ACTCCATTCACACACTGGGTT 3′   (SEQ ID NO:7)                       5′ AACGAGAAGAGGAGATACAAG 3′   (SEQ ID NO:8)                               wherein T is substituted by C at a site −108 (mutation site 4).    
     
     
         14 . The kit according to  claim 12 , further comprising at least one primer selected from: 
 a primer which comprises both nucleotide sequences of primer set 1:                                          5′ ATAGGCGTAAGCCATCATCCC 3′   (SEQ ID NO:1)                       5′ CATCCTGGTTCCTCCCTCTTT 3′   (SEQ ID NO:2)                               and is used to amplify a DNA derived from a human defensin gene;    a primer which comprises both nucleotide sequences of primer set 2:                                          5′ TGTTTCTCAAACTGCCCTTAG 3′   (SEQ ID NO:3)                       5′ ATGGGATTGTGACTACATGTG 3′   (SEQ ID NO:4)                               and is used to amplify a DNA derived from a human defensin gene;    a primer which comprises both nucleotide sequences of primer set 3:                                          5′ TCCGGACCCACTTGAGACTCC 3′   (SEQ ID NO:5)                       5′ GAAAATTCCTCCTATCTTGCA 3′   (SEQ ID NO:6)                               and is used to amplify a DNA derived from a human defensin gene;    a primer which comprises both nucleotide sequences of primer set 4:                                          5′ ACTCCATTCACACACTGGGTT 3′   (SEQ ID NO:7)                       5′ AACGAGAAGAGGAGATACAAG 3′   (SEQ ID NO:8)                               and is used to amplify a DNA derived from a human defensin gene.    
     
     
         15 . A DNA chip wherein the DNA chip comprises at least one type of a probe comprising a nucleotide sequence to detect a mutant type sequence existing in the promoter region of a human defensin 2 gene, and optionally comprising a primer such as at least 5 nucleotides being each of upstream and downstream from a mutation site and otherwise at-least-10-nucleotide-containing sequences of which 3′ terminus is the nucleotide of a mutation site in the promoter nucleotide sequences, so as to detect a mutant gene existing in the promoter region of a human defensin gene.  
     
     
         16 . The DNA chip according to  claim 15 , wherein the nucleotide sequence used as a probe is at least one sequence selected from:  
       a DNA nucleotide sequence amplified by primer set 1:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ ATAGGCGTAAGCCATCATGCC 3′ 
                   (SEQ ID NO:1) 
                     
                 
                     
                     
                 
                     
                   5′ CATCCTGGTTCCTCCCTCTTT 3′ 
                   (SEQ ID NO:2) 
                 
                     
                     
                 
             
                
                
                
                
                
               
            
           
         
         wherein G is substituted by C at a site −1431 located upstream of the transcription initiation point of the human β-defensin 2 gene, and/or  
         a DNA nucleotide sequence amplified by primer set 2:  
         
           
             
                   
                   
                   
                   
                 
                       
                       
                   
                       
                     5′ TGTTTCTCAAACTGCCCTTAG 3′ 
                     (SEQ ID NO:3) 
                       
                   
                       
                       
                   
                       
                     5′ ATGGGATTGTGACTACATGTG 3′ 
                     (SEQ ID NO:4) 
                   
                       
                       
                   
               
                  
                  
                  
                  
                  
                 
              
             
           
         
         wherein G is substituted by T at a site −1035 (mutation site 2-1), and/or A is substituted by G at a site −1027 (mutation site 2-2), and/or G is substituted by A at a site −936(mutation site 2-3), and/or C is substituted by T at a site −923 (mutation site 2-4), and/or  
         a DNA nucleotide sequence amplified by the same primer set as above, wherein T is substituted by C at a site −912 (mutation site 2-5), and/or G is substituted by A at a site −874 (mutation site 2-6), and/or  
         a DNA nucleotide sequence amplified by primer set 3:  
         
           
             
                   
                   
                   
                   
                 
                       
                       
                   
                       
                     5′ TCCGGACCCACTTGAGACTCC 3′ 
                     (SEQ ID NO:5) 
                       
                   
                       
                       
                   
                       
                     5′ GAAAATTCCTCCTATCTTGCA 3′ 
                     (SEQ ID NO:6) 
                   
                       
                       
                   
               
                  
                  
                  
                  
                  
                 
              
             
           
         
         wherein C is substituted by T at a site −539 (mutation site 3-1), and/or A is substituted by G at a site −472 (mutation site 3-2), and/or  
         a DNA nucleotide sequence amplified by primer set 4:  
         
           
             
                   
                   
                   
                   
                 
                       
                       
                   
                       
                     5′ ACTCCATTCACACACTGGGTT 3′ 
                     (SEQ ID NO:7) 
                       
                   
                       
                       
                   
                       
                     5′ AACGAGAAGAGGAGATACAAG 3′ 
                     (SEQ ID NO:8) 
                   
                       
                       
                   
               
                  
                  
                  
                  
                  
                 
              
             
           
         
         wherein T is substituted by C at a site −108 (mutation site 4).  
       
     
     
         17 . The DNA chip according to  claim 15 , further comprising at least one primer selected from:  
       a primer which comprises both nucleotide sequences of primer set 1:  
       
         
           
                 
                 
                 
                 
               
                     
                     
                 
                     
                   5′ ATAGGCGTAAGCCATCATGCC 3′ 
                   (SEQ ID NO:1) 
                     
                 
                     
                     
                 
                     
                   5′ CATCCTGGTTCCTCCCTCTTT 3′ 
                   (SEQ ID NO:2) 
                 
                     
                     
                 
             
                
                
                
                
                
               
            
           
         
       
       and is used to amplify a DNA derived from a human defensin gene; 
 a primer which comprises both nucleotide sequences of primer set 2:  
                                       5′ TGTTTCTCAAACTGCCCTTAG 3′   (SEQ ID NO:3)                       5′ ATGGGATTGTGACTACATGTG 3′   (SEQ ID NO:4)                             
 and is used to amplify a DNA derived from a human defensin gene;  
 a primer which comprises both nucleotide sequences of primer set 3:  
                                       5′ TCCGGACCCACTTGAGACTCC 3′   (SEQ ID NO:5)                       5′ GAAAATTCCTCCTATCTTGCA 3′   (SEQ ID NO:6)                             
 and is used to amplify a DNA derived from a human defensin gene;  
 a primer which comprises both nucleotide sequences of primer set 4:  
                                       5′ ACTCCATTCACACACTGGGTT 3′   (SEQ ID NO:7)                       5′ AACGAGAAGAGGAGATACAAG 3′   (SEQ ID NO:8)                             
 and is used to amplify a DNA derived from a human defensin gene.  
 
     
     
         18 . A method for estimating susceptibility to periodontal disease on the basis of nucleotide sequences revealed by a human allele analysis, using the allele specific PCR method.