Novel regulatory elements of cold-inducible hutU gene from the Antarctic psychrotrophic bacterium Pseudomonas Syringae

Abstract

A DNA sequence from the upstream region of cold-inducible hutU gene of the Antarctic Psychrotrophic Bacterium Pseudomonas Syringae , comprising promoter elements and other regulatory sequences, with unique ‘CAAAA’ nucleotide sequence at −10 site of multiple transcription start sites and using said promoter to express genes of interest in the said bacterium at temperature as low as 4° C. and using the said bacterium with generation time ranging between two and half to three hours, as a system to produce low temperature labile proteins of pharmaceutical significance.

1 . A DNA sequence from nucleotide 2961 to 3600 of the upstream region of cold-inducible hutU region of the Antarctic Psychrotrophic Bacterium  Pseudomonas Syringae  of accession No.AF326719, comprising promoter elements and other regulatory sequences, with unique ‘CAAAA’ nucleotide sequence at −10 site of multiple transcription start sites and using said promoter to express genes of interest in the said bacterium at temperature as low as 40° C. and using the said bacterium with generation time ranging between two and half to three hours, as a system to produce low temperature labile proteins of pharmaceutical significance.  
     
     
         2 . A sequence as claimed in  claim 1  wherein, said promoter has two transcription initiation sites with low temperature (4° C.), and common low and high temperature (4° C. and 22° C.) specificity.  
     
     
         3 . A sequence as claimed in  claim 1  wherein, the amount of transcripts produced at 4° C. from the hutU gene and hut operon is about 20-fold higher than the amount present at 22° C. during the steady-state growth of the said bacterium.  
     
     
         4 . A sequence promoter as claimed in  claim 1  wherein, the said gene is inducible upon a downshift of temperature from 22 to 4° C.  
     
     
         5 . A sequence as claimed in  claim 1  wherein, HutU is the Open Reading Frame (ORF) of hutU gene.  
     
     
         6 . A sequence as claimed in  claim 1  wherein, amount of mRNAs from the hutU operon increased only about two to three folds on temperature downshift of the said bacterium from 22 to 4° C.  
     
     
         7 . A sequence as claimed in  claim 1  wherein, amount of transcripts produced at 4 and 22° C. or from “cold-shocked” cells after a shift of the culture from 22 to 4° at different time points of 0, 0.5, 1, 2, and 3 hours after that shift.  
     
     
         8 . A sequence as claimed in  claim 7  wherein, the amount of mRNAs is at maximum by 2 hours after the shift and decreased subsequently.  
     
     
         9 . A sequence as claimed in  claim 1  wherein, 4° C. specific transcription start site starts with a G, which is 219 nucleotides upstream of the translation initiation codon GTG of the HutU ORF.  
     
     
         10 . A sequence as claimed in  claim 1  wherein, the common transcription start site for both low and high temperature is located 39 nucleotides from the low temperature transcription start site.  
     
     
         11 . A sequence as claimed in  claim 1  wherein, the −35 sequence in the promoter region of the 4° C. specific transcript is TGTTAC.  
     
     
         12 . A sequence as claimed in  claim 1  wherein, the −35 sequence in the promoter region of the 4 and 22° C. common transcript is CCTGCG.  
     
     
         13 . A sequence as claimed in  claim 1  wherein, the 4° C. specific transcript has second CAAAA sequence at the −15 position.  
     
     
         14 . A sequence as claimed in  claim 13  wherein, the second CAAAA nucleotide sequence at low temperature transcript is important for increased expression of the gene at lower temperature.  
     
     
         15 . A sequence as claimed in  claim 1  wherein, sequence at the upstream of the GTG translational start codon of the hutU gene contain HutC repressor binding motif CTTGTATGTACAAG.  
     
     
         16 . A sequence as claimed in  claim 1  wherein, catabolite activator protein (CAP) binding sequence, AAGTGTGCGTCGACCCTCTTGT, is located 35 nucleotides upstream of the GTG translation initiation codon of the hutU-ORF.  
     
     
         17 . A sequence as claimed in  claim 16  wherein, said Catabolite Repressor acts as transcriptional roadblock for RNA polymerase.  
     
     
         18 . A sequence as claimed in  claim 1  wherein, a conserved “cold-box”-like sequence, TTGATGAACAACC, is located 123 nucleotides downstream of the translation initiation codon of HutU-ORF.  
     
     
         19 . A sequence as claimed in  claim 1  wherein, nitrogen regulatory σ N  promoter element, GGCCGCTTACTTGC, is located 81 nucleotides upstream of the translation start site of the HutU-ORF.  
     
     
         20 . A sequence as claimed in  claim 1  wherein, said HutU gene can not be expressed in  E. coli  at temperature of about 15° C. and below.  
     
     
         21 . A sequence as claimed in  claim 1  wherein, the Shine-Dalgarno (SD) sequence, GAGGA, is located 12 nucleotides upstream of the translation initiation codon GTG of the hutU ORF.  
     
     
         22 . A sequence as claimed in  claim 1  wherein, the cold-shock protein binding sequence, ATTGG, is located 186 nucleotides downstream of the translational initiation codon GTG of hutU ORF.  
     
     
         23 . A sequence as claimed in  claim 1  wherein, regulatory sequence GCGAGCTCTTGAATGCGGCCACCAAGAGCTCGC, having hairpin loop structure is located 70 nucleotides upstream of low temperature transcription start site.  
     
     
         24 . A sequence as claimed in  claim 23  wherein, change of free energy (ΔG) for the said loop is about −16.6 kcal.  
     
     
         25 . A sequence as claimed in  claim 23  wherein, said loop functions as a transcription stop signal for the upstream hutC gene.  
     
     
         26 . A sequence as claimed in  claim 23  wherein, said loop functions as a regulatory element for transcription of the hutU gene.  
     
     
         27 . A method of cloning and expressing cold-inducible hutU gene from the Antarctic Psychrotropic Bacterium  Pseudomonas Syringae,  said method comprising steps of: 
 d. cloning 2.4 kbp Pst DNA fragment containing hutU gene, and three overlapping fragments containing upstream 3.5 kbp Eco-RI-Kpn I fragment, downstream 2.54 Kbp SalI and 1.2 Kbp Pst I fragments into pUC19,    e. sequencing the clone, and    f. expressing the sequence clone.    
     
     
         28 . A method of expressing gene encoding low-temperature labile proteins of interest using DNA sequence of  claim 1 , said method comprising introducing said sequence at the upstream region of the gene, and expression the said gene, obtaining protein of interest.