US2003153740A1PendingUtilityA1

Novel steroid/thyroid hormone receptor-related gene, which is inappropriately expressed in human heptocellular carcinoma, and which is a retinoic acid receptor

Assignee: PASTEUR INSTITUTPriority: Dec 16, 1987Filed: Dec 2, 2002Published: Aug 14, 2003
Est. expiryDec 16, 2007(expired)· nominal 20-yr term from priority
C12Q 1/6876C07K 14/70567C12Q 2600/158
57
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A previously isolated hepatitis B virus (HBV) integration in a 147 bp cellular DNA fragment linked to hepatocellular carcinoma (HCC) was used as a probe to clone the corresponding complementary DNA from a human liver cDNA library. Nucleotide sequence analysis revealed that the overall structure of the cellular gene, which has been named hap, is similar to that of the DNA-binding hormone receptors. Six out of seven hepatoma and hepatoma-derived cell-lines express a 2.5 kb hap mRNA species which is undetectable in normal adult and fetal livers, but present in all non-hepatic tissues analyzed. Low stringency hybridization experiments revealed the existence of hap related genes in the human genome. The cloned DNA sequence is useful in the preparation of pure hap protein and as a probe in the detection and isolation of complementary DNA and RNA sequences. The hap protein is a retinoic acid (RA) receptor identified as RAR-β.

Claims

exact text as granted — not AI-modified
what is claimed is:  
     
         1 . A cloned DNA sequence encoding a polypeptide of hap gene, wherein the sequence has the formula  
       
         
           
                 
                 
               
                     
                 
                   ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTGAT 
                     
                 
                     
                 
                   TCTACACTGCGAGTCCGTCTTCCTGCATGCTCCAGGAGAAAGCTCTCAAA 
                 
                     
                 
                   GCATGCTTCAGTGGATTGACCCAAACCGAATGGCAGCATCGGCACACTGC 
                 
                     
                 
                   TCAATCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAGCC 
                 
                     
                 
                   CCCCATCTCCACTTCCTCCCCCTCGAGTGATCAAACCCTGCTTCGTCTGC 
                 
                     
                 
                   CAGGACAAATCATCAGGGTACCACTATGGGGTCAGCGCCTGTGAGGGATG 
                 
                     
                 
                   AAGGGCTTTTTCCGCAGAAGTATTCAGAAGAATATGATTTACACTTGTCA 
                 
                     
                 
                   CCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGCCAAT 
                 
                     
                 
                   ACTGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTC 
                 
                     
                 
                   AGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATGCAC 
                 
                     
                 
                   AGAGAGCTATGAAATGACAGCTGAGTTGGACGATCTCACAGAGAAGATCC 
                 
                     
                 
                   GAAAAGCTCACCAGGAAACTTTCCCTTCACTCTCGCAGCTGGGTAAATAC 
                 
                     
                 
                   ACCACGAATTCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTG 
                 
                     
                 
                   GGACAAATTCAGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGT 
                 
                     
                 
                   TTGCTAAACGTCTGCCTGGTTTCACTGGCTTGACCATCGCAGACCAAATT 
                 
                     
                 
                   ACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGAATTTGCAC 
                 
                     
                 
                   CAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCCTTACCC 
                 
                     
                 
                   TAAATCGAACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTT 
                 
                     
                 
                   GTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGA 
                 
                     
                 
                   AACAGGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGACCGCCAGGACC 
                 
                     
                 
                   TTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCA 
                 
                     
                 
                   CTAAAAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCC 
                 
                     
                 
                   AAAGATCTTAATGAAAATCACAGATCTCCGTAGCATCAGTGCTAAAGGTG 
                 
                     
                 
                   CAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGATCAATGCCACCT 
                 
                     
                 
                   CTCATTCAAGAAATGATGGAGAATTCTGAAGGACATGAACCCTTGACCCC 
                 
                     
                 
                   AAGTTCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCT 
                 
                     
                 
                   CAGTGGAAAACAGTGGGGTCAGTCAGTCACCACTCGTGCAATAA, 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       and serotypic variants thereof, wherein said DNA is in a purified form.  
     
     
         2 . DNA sequence as claimed in  claim 1 , which is free of human serum proteins, viral proteins, and nucleotide sequences encoding said proteins.  
     
     
         3 . DNA sequence as claimed in  claim 1 , which is free of human tissue.  
     
     
         4 . DNA sequence as claimed in  claim 1 , wherein the sequence has the formula:  
       
         
           
                 
               
                     
                 
                   GTCAGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATG 
                     
                 
                 
                 
               
                   C. 
                     
                 
                     
                 
             
                
                
               
            
             
                
                
               
            
           
         
       
     
     
         5 . DNA sequence as claimed in  claim 1 , wherein the sequence has the formula:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   GCTGAGTTGGACCATCTCACAGAGAAGATCCGA. 
                     
                 
                     
                     
                 
             
                
                
                
               
            
           
         
       
     
     
         6 . DNA sequence as claimed in  claim 1 , wherein the sequence has the formula:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   GGGGTCACTCAGTCACCACTCGTGCAA. 
                     
                 
                     
                     
                 
             
                
                
                
               
            
           
         
       
     
     
         7 . DNA sequence as claimed in  claim 1 , wherein the sequence has the formula:  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   AATGACAGGAACAAGAAAAAGAAGGAGACT. 
                     
                 
                     
                     
                 
             
                
                
                
               
            
           
         
       
     
     
         8 . DNA sequence as claimed in  claim 1 , wherein the sequence has the formula:  
       
         
           
                 
                 
               
                     
                 
                   ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTCGA 
                     
                 
                     
                 
                   TTTCTACACTGCGAGTCCGTCTTCCTGCATGCTCCAGGAGAAAGCTCTCA 
                 
                     
                 
                   AAGCATGCTTCAGTGGATTGACCCAAACCGAATGGCAGCATCGGCACACT 
                 
                     
                 
                   GCTCAATCA. 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         9 . DNA sequence as claimed in  claim 1 , wherein the sequence has the formula:  
       
         
           
                 
                 
               
                     
                 
                   CATGAACCCTTGACCCCAAGTTCAAGTGGGAACACAGCAGAGCACACTCC 
                     
                 
                     
                 
                   TAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTCACTCAGTCACCAC 
                 
                     
                 
                   TCGTGCAA. 
                 
                     
                 
             
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         10 . A DNA probe consisting essentially of a radionuclide bonded to the DNA sequence of  claim 1 .  
     
     
         11 . A hybrid duplex molecule consisting essentially of the DNA sequence of  claim 1  hydrogen bonded to a nucleotide sequence of complementary base sequence.  
     
     
         12 . Hybrid duplex molecule as claimed in  claim 9 , wherein said nucleotide sequence is a DNA sequence.  
     
     
         13 . Hybrid duplex molecule as claimed in  claim 9 , wherein said nucleotide sequence is a RNA sequence.  
     
     
         14 . Hybrid duplex molecule as claimed in  claim 9 , wherein a radionuclide label is bonded to said DNA sequence.  
     
     
         15 . A polypeptide comprising an amino acid sequence of hap protein, wherein the polypeptide contains the amino acid sequence 
 MetPheAspCysMetAspValLeuSerValSerProGlyGlnIleLeuAspPheTyrThrAla SerProSerSerCysMetLeuGlnGluLysAlaLeuLysAlaCysPheSerGlyLeuThrGln ThrGluTrpGlnHisArgHisThrAlaGlnSerIleGluThrGlnSerThrSerSerGluGlu LeuValProSerProProSerProLeuProProProArgValTyrLysProCysPheValCys GlnAspLysSerSerGlyTyrHisTyrGlyValSerAlaCysGluGlyCysLysGlyPhePhe ArgArgSerIleGlnLysAsnMetIleTyrThrCysHisArgAspLysAsnCysValIleAsn LysValThrArgAsnArgCysGlnTyrCysArgLeuGlnLysCysPheGluValGlyMetSer LysGluSerValArgAsnAspArgAsnLysLysLysLysGluThrSerLysGlnGluCysThr GluSerTyrGluMetThrAlaGluLeuAspAspLeuThrGluLysIleArgLysAlaHisGln GluThrPheProSerLeuCysGlnLeuGlyLysTyrThrThrAsnSerSerAlaAspHisArg ValArgLeuAspLeuGlyLeuTrpAspLysPheSerGluLeuAlaThrLysCysIleIleLys IleValGluPheAlaLysArgLeuProGlyPheThrGlyLeuThrIleAlaAspGlnIleThr LeuLeuLysAlaAlaCysLeuAspIleLeuIleLeuArgIleCysThrArgTyrThrProGlu GlnAspThrMetThrPheSerAspGlyLeuThrLeuAsnArgThrGlnMetHisAsnAlaGly PheGlyProLeuThrAspLeuValPheThrPheAlaAsnGlnLeuLeuProLeuGluMetAsp AspThrGluThrGlyLeuLeuSerAlaIleCysLeuIleCysGlyAspArgGlnAspLeuGlu GluProThrLysValAspLysLeuGlnGluProLeuLeuGluAlaLeuLysIleTyrIleArg LysArgArgProSerLysProHisMetPheProLysIleLeuMetLysIleThrAspLeuArg SerIleSerAlaLysGlyAlaGluArgValIleThrLeuLysMetGlulleProGlySerMet ProProLeuIleGlnGluMetMetGluAsnSerGluGlyHisGluProLeuThrProSerSer SerGlyAsnThrAlaGluHisSerProSerIleSerProSerSerValGluAsnSerGlyVal SerGlnSerProLeuValGln,    and serotypic variants and fragments thereof, wherein said polypeptide is free from human serum proteins, virus, viral protein, human tissue, and human tissue components.    
     
     
         16 . Polypeptide as claimed in  claim 15 , which is free from human, blood-derived protein.  
     
     
         17 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 GlnHisArgHisThrAlaGlnSerIleGluThrGlnSerThrSerSerGluGlu LeuValProSerProProSerProLeuProProProArgvalTyrLysProCysPheValCys GlnAspLysSerSerGlyTyrHisTyrGlyValSerAlaCysGluGlyCysLysGlyPhePhe ArgArgSerIleGlnLysAsnMetIleTyrThrcysHisArgAspLysAsnCysvalIleAsn LysValThrArgAsnArgCysGlnTyrCysArgLeuGlnLysCysPheGluValGlyMetSer LysGluSerValArgAsnAspArgAsnLysLysLysLysGluThrSerLysGlnGluCysThr GluSerTyrGluMetThrAlaGluLeuAspAspLeuThrGluLysIleArgLysAlaHisGln GluThrPheProSerLeuCys.    
     
     
         18 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 ValArgAsnAspArgAsnLysLysLysLysGluhrSerLysGlnGluCys (peptide 1);    and serotypic variants thereof.    
     
     
         19 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 AsnAspArgAsnLysLysLysLysGluThrCys (peptide 2);    and serotypic variants thereof.    
     
     
         20 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 CysGlyValSerGlnSerProLeuValGln (peptide 3);    and serotypic variants thereof.    
     
     
         21 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 AlaGluLeuAspAspLeuThrGluLysIleArg;    and serotypic variants thereof.    
     
     
         22 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 MetPheAspCysMetAspValLeuSerValSerProGlyGlnIleLeuAspPheTyrThr AlaSerProSerSerCysMetLeuGlnGluLysAlaLeuLysAlaCysPheSerGlyLeu ThrGlnThrGluTrpGlnHisArgHisThrAlaGlnSer.    
     
     
         23 . A polypeptide as claimed in  claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence: 
 HisGluProLeuThrProSerSerSerGlyAsnThrAlaGluHisSerProSer IleSerProSerSerValGluAsnSerGlyValSerGlnSerProLeuValGln    
     
     
         24 . A process for selecting a nucleotide sequence coding for hap protein or a portion thereof from a group of nucleotide sequences comprising the step of determining which of said nucleotide sequences hybridizes to a DNA sequence as claimed in  claim 1 .  
     
     
         25 . Process as claimed in  claim 20 , wherein said nucleotide sequence is a DNA sequence.  
     
     
         26 . Process as claimed in  claim 21 , wherein said nucleotide sequence is selected by Southern blot technique.  
     
     
         27 . Process as claimed in  claim 20 , wherein said nucleotide sequence is a RNA sequence.  
     
     
         28 . Process as claimed in  claim 23 , wherein said nucleotide sequence is selected by Northern blot technique.  
     
     
         29 . Process as claimed in  claim 20 , wherein said process comprises the step of detecting a label bonded to said DNA sequence.  
     
     
         30 . Process as claimed in  claim 25 , wherein said label is a radionuclide.  
     
     
         31 . A recombinant vector comprising lambda-NM1149 having an EcoRI restriction endonuclease site into which has been inserted the DNA sequence as claimed in  claim 1 .  
     
     
         32 . Plasmid pCOD20.  
     
     
         33 . An  E. coli  bacterial culture in a purified form, wherein the culture comprises  E. coli  cells containing DNA, wherein a portion of said DNA comprises the DNA sequence as claimed in  claim 1 .  
     
     
         34 . Bacterial culture as claimed in  claim 27 , wherein said cells are comprised of  E. coli  strain TG-1.  
     
     
         35 . A method for assaying a fluid for the presence of an agonist or antagonist to retinoic acid receptor RAR-β, wherein the method comprises 
 (A) providing an aqueous solution containing a known concentration of the proteinaceous receptor as claimed in  claim 13;   
 (B) incubating the receptor with the fluid suspected of containing the agonist or antagonist under conditions sufficient to bind the receptor to the agonist or antagonist; and  
 (C) determining whether there is change in concentration of the proteinaceous receptor in the aqueous solution.  
 
     
     
         36 . Method as claimed in  claim 35 , wherein the receptor and the agonist or antagonist form a complex.  
     
     
         37 . Method as claimed in  claim 36 , wherein a crosslinking agent is present in an amount sufficient to inhibit dissociation of the receptor and the agonist or antagonist.  
     
     
         38 . A cloned DNA sequence encoding a polypeptide of hap gene, wherein the sequence has the formula  
       
         
           
                 
                 
               
                     
                 
                                                                              CCCATGC 
                     
                 
                     
                 
                   GAGCTGTTTGAAGGACTGGGATGCCGAGAACGCGAGCGATCCGAGCAGGGTTTGTCTGGGCACCGT 
                 
                     
                 
                   ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTGATTCTACACTGCGAGTCC 
                 
                     
                 
                   GTCTTCCTGCATGCTCCAGGAGAAAGCTCTCAAAGCATGCTTCAGTGGATTGACCCAAACCGAATG 
                 
                     
                 
                   GCAGCATCGGCACACTGCTCAATCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAG 
                 
                     
                 
                   CCCCCCATCTCCACTTCCTCCCCCTCGAGTGATCAAACCCTGCTTCGTCTGCCAGGACAAATCATC 
                 
                     
                 
                   AGGGTACCACTATGGGGTCAGCGCCTGTGAGGGATGAAGGGCTTTTTCCGCAGAAGTATTCAGAAG 
                 
                     
                 
                   AATATGATTTACACTTGTCACCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGC 
                 
                     
                 
                   CAATACTGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGGAATGACAGG 
                 
                     
                 
                   AACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATGCACAGAGAGCTATGAAATGACAGCTGAGTTG 
                 
                     
                 
                   GACGATCTCACAGAGAAGATCCGAAAAGCTCACCAGGAAACTTTCCCTTCACTCTCGCAGCTGGGT 
                 
                     
                 
                   AAATACACCACGAATTCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTGGGACAAATTC 
                 
                     
                 
                   AGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGTTTGCTAAACGTCTGCCTGGTTTCACT 
                 
                     
                 
                   GGCTTGACCATCGCAGACCAAATTACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGA 
                 
                     
                 
                   ATTTGCACCAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCCTTACCCTAAATCGA 
                 
                     
                 
                   ACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTTGTGTTCACCTTTGCCAACCAGCTC 
                 
                     
                 
                   CTGCCTTTGGAAATGGATGACACAGAAACAGGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGAC 
                 
                     
                 
                   CGCCAGCACCTTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCACTAAAA 
                 
                     
                 
                   ATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCCAAAGATCTTAATGAAAATCACK 
                 
                     
                 
                   GATCTCCGTAGCATCAGTGCTAAAGGTGCAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGA 
                 
                     
                 
                   TCAATGCCACCTCTCATTCAAGAAATGATGGAGAATTCTGAAGGACATGAACCCTTGACCCCAAGT 
                 
                     
                 
                   TCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTC 
                 
                     
                 
                   AGTCAGTCACCACTCGTGCAATAA, 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
       and serotypic variants thereof, wherein said DNA is in a purified form.  
     
     
         39 . DNA sequence as claimed in  claim 38 , which is free of human serum proteins, viral proteins, and nucleotide sequences encoding said proteins.  
     
     
         40 . DNA sequence as claimed in  claim 1 , which is free of human tissue.  
     
     
         41 . A DNA probe consisting essentially of a radionuclide bonded to the DNA sequence of  claim 38 .  
     
     
         42 . A hybrid duplex molecule consisting essentially of the DNA sequence of  claim 38  hydrogen bonded to a nucleotide sequence of complementary base sequence.  
     
     
         43 . Hybrid duplex molecule as claimed in  claim 11 , wherein said nucleotide sequence is a DNA sequence.  
     
     
         44 . Hybrid duplex molecule as claimed in  claim 11 , wherein said nucleotide sequence is a RNA sequence.  
     
     
         45 . Hybrid duplex molecule as claimed in  claim 11 , wherein a radionuclide label is bonded to said DNA sequence.  
     
     
         46 . A process for selecting a nucleotide sequence coding for hap protein or a portion thereof from a group of nucleotide sequences comprising the step of determining which of said nucleotide sequences hybridizes to a DNA sequence as claimed in  claim 38 .  
     
     
         47 . Process as claimed in  claim 24 , wherein said nucleotide sequence is a DNA sequence.  
     
     
         48 . Process as claimed in  claim 24 , wherein said nucleotide sequence is selected by Southern blot technique.  
     
     
         49 . Process as claimed in  claim 46 , wherein said nucleotide sequence is a RNA sequence.  
     
     
         50 . Process as claimed in  claim 46 , wherein said nucleotide sequence is selected by Northern blot technique.  
     
     
         51 . Process as claimed in  claim 46 , wherein said process comprises the step of detecting a label bonded to said DNA sequence.  
     
     
         52 . Process as claimed in  claim 51 , wherein said label is a radionuclide.  
     
     
         53 . A recombinant DNA molecule comprising a DNA sequence of coding for a retinoic acid receptor, said DNA sequence coding on expression in a unicellular host for a polypeptide displaying the retinoic acid and DNA binding properties of RAR-β and being operatively linked to an expression control sequence in said DNA molecule.  
     
     
         54 . Plasmid pPROHAP.  
     
     
         55 . An  E. coli  bacterial culture in a purified form, wherein the culture comprises  E. coli  cells containing DNA, wherein a portion of said DNA comprises the DNA sequence as claimed in  claim 38 .  
     
     
         56 . Bacterial culture as claimed in  claim 55 , wherein said cells are comprised of  E. coli  strain DH5αF′.

Join the waitlist — get patent alerts

Track US2003153740A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.