Novel steroid/thyroid hormone receptor-related gene, which is inappropriately expressed in human heptocellular carcinoma, and which is a retinoic acid receptor
Abstract
A previously isolated hepatitis B virus (HBV) integration in a 147 bp cellular DNA fragment linked to hepatocellular carcinoma (HCC) was used as a probe to clone the corresponding complementary DNA from a human liver cDNA library. Nucleotide sequence analysis revealed that the overall structure of the cellular gene, which has been named hap, is similar to that of the DNA-binding hormone receptors. Six out of seven hepatoma and hepatoma-derived cell-lines express a 2.5 kb hap mRNA species which is undetectable in normal adult and fetal livers, but present in all non-hepatic tissues analyzed. Low stringency hybridization experiments revealed the existence of hap related genes in the human genome. The cloned DNA sequence is useful in the preparation of pure hap protein and as a probe in the detection and isolation of complementary DNA and RNA sequences. The hap protein is a retinoic acid (RA) receptor identified as RAR-β.
Claims
exact text as granted — not AI-modifiedwhat is claimed is:
1 . A cloned DNA sequence encoding a polypeptide of hap gene, wherein the sequence has the formula
ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTGAT
TCTACACTGCGAGTCCGTCTTCCTGCATGCTCCAGGAGAAAGCTCTCAAA
GCATGCTTCAGTGGATTGACCCAAACCGAATGGCAGCATCGGCACACTGC
TCAATCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAGCC
CCCCATCTCCACTTCCTCCCCCTCGAGTGATCAAACCCTGCTTCGTCTGC
CAGGACAAATCATCAGGGTACCACTATGGGGTCAGCGCCTGTGAGGGATG
AAGGGCTTTTTCCGCAGAAGTATTCAGAAGAATATGATTTACACTTGTCA
CCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGCCAAT
ACTGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTC
AGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATGCAC
AGAGAGCTATGAAATGACAGCTGAGTTGGACGATCTCACAGAGAAGATCC
GAAAAGCTCACCAGGAAACTTTCCCTTCACTCTCGCAGCTGGGTAAATAC
ACCACGAATTCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTG
GGACAAATTCAGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGT
TTGCTAAACGTCTGCCTGGTTTCACTGGCTTGACCATCGCAGACCAAATT
ACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGAATTTGCAC
CAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCCTTACCC
TAAATCGAACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTT
GTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGA
AACAGGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGACCGCCAGGACC
TTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCA
CTAAAAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCC
AAAGATCTTAATGAAAATCACAGATCTCCGTAGCATCAGTGCTAAAGGTG
CAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGATCAATGCCACCT
CTCATTCAAGAAATGATGGAGAATTCTGAAGGACATGAACCCTTGACCCC
AAGTTCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCT
CAGTGGAAAACAGTGGGGTCAGTCAGTCACCACTCGTGCAATAA,
and serotypic variants thereof, wherein said DNA is in a purified form.
2 . DNA sequence as claimed in claim 1 , which is free of human serum proteins, viral proteins, and nucleotide sequences encoding said proteins.
3 . DNA sequence as claimed in claim 1 , which is free of human tissue.
4 . DNA sequence as claimed in claim 1 , wherein the sequence has the formula:
GTCAGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATG
C.
5 . DNA sequence as claimed in claim 1 , wherein the sequence has the formula:
GCTGAGTTGGACCATCTCACAGAGAAGATCCGA.
6 . DNA sequence as claimed in claim 1 , wherein the sequence has the formula:
GGGGTCACTCAGTCACCACTCGTGCAA.
7 . DNA sequence as claimed in claim 1 , wherein the sequence has the formula:
AATGACAGGAACAAGAAAAAGAAGGAGACT.
8 . DNA sequence as claimed in claim 1 , wherein the sequence has the formula:
ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTCGA
TTTCTACACTGCGAGTCCGTCTTCCTGCATGCTCCAGGAGAAAGCTCTCA
AAGCATGCTTCAGTGGATTGACCCAAACCGAATGGCAGCATCGGCACACT
GCTCAATCA.
9 . DNA sequence as claimed in claim 1 , wherein the sequence has the formula:
CATGAACCCTTGACCCCAAGTTCAAGTGGGAACACAGCAGAGCACACTCC
TAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTCACTCAGTCACCAC
TCGTGCAA.
10 . A DNA probe consisting essentially of a radionuclide bonded to the DNA sequence of claim 1 .
11 . A hybrid duplex molecule consisting essentially of the DNA sequence of claim 1 hydrogen bonded to a nucleotide sequence of complementary base sequence.
12 . Hybrid duplex molecule as claimed in claim 9 , wherein said nucleotide sequence is a DNA sequence.
13 . Hybrid duplex molecule as claimed in claim 9 , wherein said nucleotide sequence is a RNA sequence.
14 . Hybrid duplex molecule as claimed in claim 9 , wherein a radionuclide label is bonded to said DNA sequence.
15 . A polypeptide comprising an amino acid sequence of hap protein, wherein the polypeptide contains the amino acid sequence
MetPheAspCysMetAspValLeuSerValSerProGlyGlnIleLeuAspPheTyrThrAla SerProSerSerCysMetLeuGlnGluLysAlaLeuLysAlaCysPheSerGlyLeuThrGln ThrGluTrpGlnHisArgHisThrAlaGlnSerIleGluThrGlnSerThrSerSerGluGlu LeuValProSerProProSerProLeuProProProArgValTyrLysProCysPheValCys GlnAspLysSerSerGlyTyrHisTyrGlyValSerAlaCysGluGlyCysLysGlyPhePhe ArgArgSerIleGlnLysAsnMetIleTyrThrCysHisArgAspLysAsnCysValIleAsn LysValThrArgAsnArgCysGlnTyrCysArgLeuGlnLysCysPheGluValGlyMetSer LysGluSerValArgAsnAspArgAsnLysLysLysLysGluThrSerLysGlnGluCysThr GluSerTyrGluMetThrAlaGluLeuAspAspLeuThrGluLysIleArgLysAlaHisGln GluThrPheProSerLeuCysGlnLeuGlyLysTyrThrThrAsnSerSerAlaAspHisArg ValArgLeuAspLeuGlyLeuTrpAspLysPheSerGluLeuAlaThrLysCysIleIleLys IleValGluPheAlaLysArgLeuProGlyPheThrGlyLeuThrIleAlaAspGlnIleThr LeuLeuLysAlaAlaCysLeuAspIleLeuIleLeuArgIleCysThrArgTyrThrProGlu GlnAspThrMetThrPheSerAspGlyLeuThrLeuAsnArgThrGlnMetHisAsnAlaGly PheGlyProLeuThrAspLeuValPheThrPheAlaAsnGlnLeuLeuProLeuGluMetAsp AspThrGluThrGlyLeuLeuSerAlaIleCysLeuIleCysGlyAspArgGlnAspLeuGlu GluProThrLysValAspLysLeuGlnGluProLeuLeuGluAlaLeuLysIleTyrIleArg LysArgArgProSerLysProHisMetPheProLysIleLeuMetLysIleThrAspLeuArg SerIleSerAlaLysGlyAlaGluArgValIleThrLeuLysMetGlulleProGlySerMet ProProLeuIleGlnGluMetMetGluAsnSerGluGlyHisGluProLeuThrProSerSer SerGlyAsnThrAlaGluHisSerProSerIleSerProSerSerValGluAsnSerGlyVal SerGlnSerProLeuValGln, and serotypic variants and fragments thereof, wherein said polypeptide is free from human serum proteins, virus, viral protein, human tissue, and human tissue components.
16 . Polypeptide as claimed in claim 15 , which is free from human, blood-derived protein.
17 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
GlnHisArgHisThrAlaGlnSerIleGluThrGlnSerThrSerSerGluGlu LeuValProSerProProSerProLeuProProProArgvalTyrLysProCysPheValCys GlnAspLysSerSerGlyTyrHisTyrGlyValSerAlaCysGluGlyCysLysGlyPhePhe ArgArgSerIleGlnLysAsnMetIleTyrThrcysHisArgAspLysAsnCysvalIleAsn LysValThrArgAsnArgCysGlnTyrCysArgLeuGlnLysCysPheGluValGlyMetSer LysGluSerValArgAsnAspArgAsnLysLysLysLysGluThrSerLysGlnGluCysThr GluSerTyrGluMetThrAlaGluLeuAspAspLeuThrGluLysIleArgLysAlaHisGln GluThrPheProSerLeuCys.
18 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
ValArgAsnAspArgAsnLysLysLysLysGluhrSerLysGlnGluCys (peptide 1); and serotypic variants thereof.
19 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
AsnAspArgAsnLysLysLysLysGluThrCys (peptide 2); and serotypic variants thereof.
20 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
CysGlyValSerGlnSerProLeuValGln (peptide 3); and serotypic variants thereof.
21 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
AlaGluLeuAspAspLeuThrGluLysIleArg; and serotypic variants thereof.
22 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
MetPheAspCysMetAspValLeuSerValSerProGlyGlnIleLeuAspPheTyrThr AlaSerProSerSerCysMetLeuGlnGluLysAlaLeuLysAlaCysPheSerGlyLeu ThrGlnThrGluTrpGlnHisArgHisThrAlaGlnSer.
23 . A polypeptide as claimed in claim 15 , wherein the polypeptide comprises a peptide fragment having the amino acid sequence:
HisGluProLeuThrProSerSerSerGlyAsnThrAlaGluHisSerProSer IleSerProSerSerValGluAsnSerGlyValSerGlnSerProLeuValGln
24 . A process for selecting a nucleotide sequence coding for hap protein or a portion thereof from a group of nucleotide sequences comprising the step of determining which of said nucleotide sequences hybridizes to a DNA sequence as claimed in claim 1 .
25 . Process as claimed in claim 20 , wherein said nucleotide sequence is a DNA sequence.
26 . Process as claimed in claim 21 , wherein said nucleotide sequence is selected by Southern blot technique.
27 . Process as claimed in claim 20 , wherein said nucleotide sequence is a RNA sequence.
28 . Process as claimed in claim 23 , wherein said nucleotide sequence is selected by Northern blot technique.
29 . Process as claimed in claim 20 , wherein said process comprises the step of detecting a label bonded to said DNA sequence.
30 . Process as claimed in claim 25 , wherein said label is a radionuclide.
31 . A recombinant vector comprising lambda-NM1149 having an EcoRI restriction endonuclease site into which has been inserted the DNA sequence as claimed in claim 1 .
32 . Plasmid pCOD20.
33 . An E. coli bacterial culture in a purified form, wherein the culture comprises E. coli cells containing DNA, wherein a portion of said DNA comprises the DNA sequence as claimed in claim 1 .
34 . Bacterial culture as claimed in claim 27 , wherein said cells are comprised of E. coli strain TG-1.
35 . A method for assaying a fluid for the presence of an agonist or antagonist to retinoic acid receptor RAR-β, wherein the method comprises
(A) providing an aqueous solution containing a known concentration of the proteinaceous receptor as claimed in claim 13;
(B) incubating the receptor with the fluid suspected of containing the agonist or antagonist under conditions sufficient to bind the receptor to the agonist or antagonist; and
(C) determining whether there is change in concentration of the proteinaceous receptor in the aqueous solution.
36 . Method as claimed in claim 35 , wherein the receptor and the agonist or antagonist form a complex.
37 . Method as claimed in claim 36 , wherein a crosslinking agent is present in an amount sufficient to inhibit dissociation of the receptor and the agonist or antagonist.
38 . A cloned DNA sequence encoding a polypeptide of hap gene, wherein the sequence has the formula
CCCATGC
GAGCTGTTTGAAGGACTGGGATGCCGAGAACGCGAGCGATCCGAGCAGGGTTTGTCTGGGCACCGT
ATGTTTGACTGTATGGATGTTCTGTCAGTGAGTCCTGGGCAAATCCTGATTCTACACTGCGAGTCC
GTCTTCCTGCATGCTCCAGGAGAAAGCTCTCAAAGCATGCTTCAGTGGATTGACCCAAACCGAATG
GCAGCATCGGCACACTGCTCAATCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAG
CCCCCCATCTCCACTTCCTCCCCCTCGAGTGATCAAACCCTGCTTCGTCTGCCAGGACAAATCATC
AGGGTACCACTATGGGGTCAGCGCCTGTGAGGGATGAAGGGCTTTTTCCGCAGAAGTATTCAGAAG
AATATGATTTACACTTGTCACCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGC
CAATACTGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGGAATGACAGG
AACAAGAAAAAGAAGGAGACTTCGAAGCAAGAATGCACAGAGAGCTATGAAATGACAGCTGAGTTG
GACGATCTCACAGAGAAGATCCGAAAAGCTCACCAGGAAACTTTCCCTTCACTCTCGCAGCTGGGT
AAATACACCACGAATTCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTGGGACAAATTC
AGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGTTTGCTAAACGTCTGCCTGGTTTCACT
GGCTTGACCATCGCAGACCAAATTACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGA
ATTTGCACCAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCCTTACCCTAAATCGA
ACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTTGTGTTCACCTTTGCCAACCAGCTC
CTGCCTTTGGAAATGGATGACACAGAAACAGGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGAC
CGCCAGCACCTTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCACTAAAA
ATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCCAAAGATCTTAATGAAAATCACK
GATCTCCGTAGCATCAGTGCTAAAGGTGCAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGA
TCAATGCCACCTCTCATTCAAGAAATGATGGAGAATTCTGAAGGACATGAACCCTTGACCCCAAGT
TCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTC
AGTCAGTCACCACTCGTGCAATAA,
and serotypic variants thereof, wherein said DNA is in a purified form.
39 . DNA sequence as claimed in claim 38 , which is free of human serum proteins, viral proteins, and nucleotide sequences encoding said proteins.
40 . DNA sequence as claimed in claim 1 , which is free of human tissue.
41 . A DNA probe consisting essentially of a radionuclide bonded to the DNA sequence of claim 38 .
42 . A hybrid duplex molecule consisting essentially of the DNA sequence of claim 38 hydrogen bonded to a nucleotide sequence of complementary base sequence.
43 . Hybrid duplex molecule as claimed in claim 11 , wherein said nucleotide sequence is a DNA sequence.
44 . Hybrid duplex molecule as claimed in claim 11 , wherein said nucleotide sequence is a RNA sequence.
45 . Hybrid duplex molecule as claimed in claim 11 , wherein a radionuclide label is bonded to said DNA sequence.
46 . A process for selecting a nucleotide sequence coding for hap protein or a portion thereof from a group of nucleotide sequences comprising the step of determining which of said nucleotide sequences hybridizes to a DNA sequence as claimed in claim 38 .
47 . Process as claimed in claim 24 , wherein said nucleotide sequence is a DNA sequence.
48 . Process as claimed in claim 24 , wherein said nucleotide sequence is selected by Southern blot technique.
49 . Process as claimed in claim 46 , wherein said nucleotide sequence is a RNA sequence.
50 . Process as claimed in claim 46 , wherein said nucleotide sequence is selected by Northern blot technique.
51 . Process as claimed in claim 46 , wherein said process comprises the step of detecting a label bonded to said DNA sequence.
52 . Process as claimed in claim 51 , wherein said label is a radionuclide.
53 . A recombinant DNA molecule comprising a DNA sequence of coding for a retinoic acid receptor, said DNA sequence coding on expression in a unicellular host for a polypeptide displaying the retinoic acid and DNA binding properties of RAR-β and being operatively linked to an expression control sequence in said DNA molecule.
54 . Plasmid pPROHAP.
55 . An E. coli bacterial culture in a purified form, wherein the culture comprises E. coli cells containing DNA, wherein a portion of said DNA comprises the DNA sequence as claimed in claim 38 .
56 . Bacterial culture as claimed in claim 55 , wherein said cells are comprised of E. coli strain DH5αF′.Join the waitlist — get patent alerts
Track US2003153740A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.