US2003099668A1PendingUtilityA1

Packaging of immunostimulatory substances into virus-like particles: method of preparation and use

Assignee: CYTOS BIOTECHNOLOGY AGPriority: Sep 14, 2001Filed: Sep 16, 2002Published: May 29, 2003
Est. expirySep 14, 2021(expired)· nominal 20-yr term from priority
A61P 37/02C12N 2710/22023A61K 2039/52A61P 33/06C07K 2319/00A61K 2039/6075A61P 31/18A61P 33/04A61P 31/06C12N 7/00A61P 31/22A61K 2039/57A61K 2039/55555A61K 39/02A61K 2039/55561A61P 33/00A61K 39/12C12N 2730/10123C12N 2795/18122A61P 31/12A61P 35/00A61P 31/20C12N 2710/22022A61P 31/04C07K 14/005C12N 2730/10122A61P 37/04A61K 39/39A61P 35/02A61K 2039/5258C12N 2795/00034A61P 37/08A61P 31/16A61K 39/001151A61K 39/001191A61K 39/001186A61K 39/001156A61K 39/001104A61K 39/001182A61K 39/001171A61K 39/001106A61K 39/001129A61K 39/001192A61K 39/0011A61K 39/00Y02A50/30
49
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

The invention relates to the finding that virus like particles (VLPs) can be loaded with immunostimulatory substances, in particular with DNA oligonucleotides containing non-methylated C and G (CpGs). Such CpG-VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses. The immune response against antigens optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself. In addition, the T cell responses against both the VLPs and antigens are especially directed to the Th1 type. Antigens attached to CpG-loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.

Claims

exact text as granted — not AI-modified
What is claimed is:  
     
         1 . A composition for enhancing an immune response in an animal comprising: 
 (a) a virus-like particle; and    (b) an immunostimulatory substance; wherein said immunostimulatory substance is bound to said virus-like particle.    
     
     
         2 . The composition of  claim 1  further comprising at least one antigen, wherein said antigen is bound to said virus-like particle.  
     
     
         3 . The composition of  claim 1 , wherein said immunostimulatory substance is a toll-like receptor activating substance.  
     
     
         4 . The composition of  claim 1 , wherein said immunostimulatory substance is a cytokine secretion inducing substance.  
     
     
         5 . The composition of  claim 3 , wherein said toll-like receptor activating substance is selected from the group consisting of, or alternatively consists essentially of: 
 (a) immunostimulatory nucleic acids;    (b) peptidoglycans;    (c) lipopolysaccharides;    (d) lipoteichonic acids;    (e) imidazoquinoline compounds;    (f) flagellines;    (g) lipoproteins;    (h) immunostimulatory organic molecules;    (i) unmethylated CpG-containing oligonucleotides; and    (j) any mixtures of at least one substance of (a), (b), (c), (d), (e), (f), (g), (h) and/or (i).    
     
     
         6 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) ribonucleic acids;    (b) deoxyribonucleic acids;    (c) chimeric nucleic acids; and    (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).    
     
     
         7 . The composition of  claim 6 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.  
     
     
         8 . The composition of  claim 6 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) unmethylated CpG-containing oligonucleotides; and    (b) oligonucleotides free of unmethylated CpG motifs.    
     
     
         9 . The composition of  claim 1 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.  
     
     
         10 . The composition of  claim 1 , wherein said virus-like particle lacks a lipoprotein-containing envelope.  
     
     
         11 . The composition of  claim 1 , wherein said virus-like particle is a recombinant virus-like particle.  
     
     
         12 . The composition of  claim 11 , wherein said virus-like particle is selected from the group consisting of: 
 (a) recombinant proteins of Hepatitis B virus;    (b) recombinant proteins of measles virus;    (c) recombinant proteins of Sinbis virus;    (d) recombinant proteins of Rotavirus;    (e) recombinant proteins of Foot-and-Mouth-Disease virus;    (f) recombinant proteins of Retrovirus;    (g) recombinant proteins of Norwalk virus;    (h) recombinant proteins of human Papilloma virus;    (i) recombinant proteins of BK virus;    (j) recombinant proteins of bacteriophages;    (k) recombinant proteins of RNA-phages;    (1) recombinant proteins of Qβ-phage;    (m) recombinant proteins of GA-phage (n) recombinant proteins of fr-phage;    (o) recombinant proteins of AP 205-phage;    (p) recombinant proteins of Ty; and    (q) fragments of any of the recombinant proteins from (a) to (p).    
     
     
         13 . The composition of  claim 12 , wherein said virus-like particle is the Hepatitis B virus core protein.  
     
     
         14 . The composition of  claim 12 , wherein said virus-like particle is the BK virus VP 1 protein.  
     
     
         15 . The composition of  claim 1 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.  
     
     
         16 . The composition of  claim 15 , wherein said RNA-phage is selected from the group consisting of: 
 (a) bacteriophage Qβ;    (b) bacteriophage R17;    (c) bacteriophage fr;    (d) bacteriophage GA;    (e) bacteriophage SP;    (f) bacteriophage MS2;    (g) bacteriophage M11;    (h) bacteriophage MX1;    (i) bacteriophage NL95;    (k) bacteriophage f2;    (1) bacteriophage PP7; and    (m) bacteriophage AP205.    
     
     
         17 . The composition of  claim 1 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage Qβ.  
     
     
         18 . The composition of  claim 1 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage AP 205.  
     
     
         19 . The composition of  claim 9 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence: 
 X 1 X 2 CGX 3 X 4 3′   wherein X 1 , X 2 , X 3 , and X 4  are any nucleotide.    
     
     
         20 . The composition of  claim 19 , wherein at least one of said nucleotide X 1 , X 2 , X 3 , and X 4  has a phosphate backbone modification.  
     
     
         21 . The composition of  claim 9 , wherein said unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence selected from the group consisting of: 
 (a) TCCATGACGTTCCTGAATAAT;    (b) TCCATGACGTTCCTGACGTT;    (c) GGGGTCAACGTTGAGGGGG;    (d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and    (e) “dsCyCpG-253” as described in Table 1.    
     
     
         22 . The composition of  claim 21 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         23 . The composition of  claim 9 , wherein said unrmethylated CpG-containing oligonucleotide is palindromic.  
     
     
         24 . The composition of  claim 23 , wherein said palindromic unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence GGGGTCAACGTTGAGGGGG.  
     
     
         25 . The composition of  claim 24 , wherein said palindromic unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         26 . The composition of  claim 1 , wherein said immunostimulatory substance is non-covalently bound to said virus-like particle.  
     
     
         27 . The composition of  claim 9 , wherein said unmethylated CpG-containing oligonucleotide is non-covalently bound to said virus-like particle.  
     
     
         28 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.  
     
     
         29 . The composition of  claim 9 , wherein said unmethylated CpG-containing oligonucleotide is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.  
     
     
         30 . The composition of  claim 29 , wherein said oligonucleotide binding site is a non-naturally occurring oligonucleotide binding site.  
     
     
         31 . The composition of  claim 29 , wherein said virus-like particle site comprises an arginine-rich repeat.  
     
     
         32 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         33 . The composition of  claim 9 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         34 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 100,000 nucleotides.  
     
     
         35 . The composition of  claim 34 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 2000 nucleotides.  
     
     
         36 . The composition of  claim 35 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 2000 nucleotides.  
     
     
         37 . The composition of  claim 36 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 300 nucleotides.  
     
     
         38 . The composition of  claim 37 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises 20 to 100 nucleotides.  
     
     
         39 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 2000 nucleotides.  
     
     
         40 . The composition of  claim 39 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 1000 nucleotides.  
     
     
         41 . The composition of  claim 40 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 500 nucleotides.  
     
     
         42 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a recombinant oligonucleotide.  
     
     
         43 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a genomic oligonucleotide.  
     
     
         44 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a synthetic oligonucleotide.  
     
     
         45 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a plasmid-derived oligonucleotide.  
     
     
         46 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a single-stranded oligonucleotide.  
     
     
         47 . The composition of  claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a double-stranded oligonucleotide.  
     
     
         48 . The composition of  claim 2 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond.  
     
     
         49 . The composition of  claim 2 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond, and wherein said covalent bond is a non-peptide bond.  
     
     
         50 . The composition of  claim 2 , wherein said at least one antigen or antigenic determinant is fused to said virus-like particle.  
     
     
         51 . The composition of  claim 2 , wherein said antigen or antigenic determinant further comprises at least one second attachment site being selected from the group consisting of: 
 (a) an attachment site not naturally occurring with said antigen or antigenic determinant; and    (b) an attachment site naturally occurring with said antigen or antigenic determinant.    
     
     
         52 . The composition of  claim 2  further comprising an amino acid linker, wherein said amino acid linker comprises, or alternatively consists of, said second attachment site.  
     
     
         53 . The composition of  claim 2 , wherein said antigen is selected from the group consisting of: 
 (a) polypeptides;    (b) carbohydrates;    (c) steroid hormones; and    (d) organic molecules.    
     
     
         54 . The composition of  claim 53 , wherein said antigen is an organic molecule.  
     
     
         55 . The composition of  claim 54 , wherein said organic molecule is selected from the group consisting of: 
 (a) codeine;    (b) fentanyl;    (c) heroin;    (d) morphium;    (e) amphetamine;    (f) cocaine;    (g) methylenedioxymethamphetamine;    (h) methamphetamine;    (i) methylphenidate;    (j) nicotine;    (k) LSD;    (l) mescaline;    (m) psilocybin; and    (n) tetrahydrocannabinol.    
     
     
         56 . The composition of  claim 2 , wherein said antigen is a recombinant antigen.  
     
     
         57 . The composition of  claim 2 , wherein said antigen is derived from the group consisting of: 
 (a) viruses;    (b) bacteria;    (c) parasites;    (d) prions;    (e) tumors;    (f) self-molecules;    (g) non-peptidic hapten molecules    (h) allergens; and    (i) hormones.    
     
     
         58 . The composition of  claim 57 , wherein said antigen is a tumor antigen.  
     
     
         59 . The composition of  claim 58 , wherein said tumor antigen is selected from the group consisting of: 
 (a) Her2;    (b) GD2;    (c) EGF-R;    (d) CEA;    (e) CD52;    (f) CD21;    (g) human melanoma protein gp100;    (h) human melanoma protein melan-A/MART-1;    (i) tyrosinase;    (j) NA 17-A nt protein;    (k) MAGE-3 protein;    (l) p53 protein;    (m) HPV16 E7 protein; and    (n) antigenic fragments of any of the tumor antigens from (a) to (m).    
     
     
         60 . The composition of  claim 2 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.  
     
     
         61 . The composition of  claim 60 , wherein said virus-like particle is the Hepatitis B virus core protein.  
     
     
         62 . The composition of  claim 60 , wherein said virus-like particle is the BK virus core protein.  
     
     
         63 . The composition of  claim 2 , wherein said antigen is a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are bound directly or by way of a linking sequence.  
     
     
         64 . The composition of  claim 63 , wherein said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.  
     
     
         65 . The composition of  claim 63 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.  
     
     
         66 . The composition of  claim 63 , wherein said virus-like particle is the Hepatitis B virus core protein.  
     
     
         67 . The composition of  claim 66 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein.  
     
     
         68 . The composition of  claim 67 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein by way of a linking sequence.  
     
     
         69 . The composition of  claim 63 , wherein said virus-like particle is the BK virus VP 1 protein.  
     
     
         70 . The composition of  claim 69 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein.  
     
     
         71 . The composition of  claim 70 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein by way of a linking sequence.  
     
     
         72 . A method for enhancing an immune response in an animal comprising introducing into said animal a composition comprising: 
 (a) a virus-like particle; and    (b) an immunostimulatory substance; wherein said immunostimulatory substance is bound to said virus-like particle.    
     
     
         73 . The method of  claim 72 , wherein said composition further comprises an antigen, wherein said antigen is bound to said virus-like particle.  
     
     
         74 . The method of  claim 72 , wherein said immunostimulatory substance is a toll-like receptor activating substance.  
     
     
         75 . The method of  claim 72 , wherein said immunostimulatory substance is a cytokine secretion inducing substance.  
     
     
         76 . The method of  claim 74 , wherein said toll-like receptor activating substance is selected from the group consisting of, or alternatively consists essentially of: 
 (a) immunostimulatory nucleic acids;    (b) peptidoglycans;    (c) lipopolysaccharides;    (d) lipoteichonic acids;    (e) imidazoquinoline compounds;    (f) flagellines;    (g) lipoproteins;    (h) immunostimulatory organic molecules;    (i) unmethylated CpG-containing oligonucleotides; and    (j) any mixtures of at least one substance of (a), (b), (c), (d), (e), (f), (g), (h) and/or (i).    
     
     
         77 . The method of  claim 76 , wherein said immunostimulatory nucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) ribonucleic acids;    (b) deoxyribonucleic acids;    (c) chimeric nucleic acids; and    (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).    
     
     
         78 . The method of  claim 77 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.  
     
     
         79 . The method of  claim 77 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) unmethylated CpG-containing oligonucleotides; and    (b) oligonucleotides free of unmethylated CpG motifs.    
     
     
         80 . The method of  claim 72 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.  
     
     
         81 . The method of  claim 72 , wherein said virus-like particle lacks a lipoprotein-containing envelope.  
     
     
         82 . The method of  claim 72 , wherein said virus-like particle is a recombinant virus-like particle.  
     
     
         83 . The method of  claim 82 , wherein said virus-like particle is selected from the group consisting of: 
 (a) recombinant proteins of Hepatitis B virus;    (b) recombinant proteins of measles virus;    (c) recombinant proteins of Sinbis virus;    (d) recombinant proteins of Rotavirus;    (e) recombinant proteins of Foot-and-Mouth-Disease virus;    (f) recombinant proteins of Retrovirus;    (g) recombinant proteins of Norwalk virus;    (h) recombinant proteins of human Papilloma virus;    (i) recombinant proteins of BK virus;    (j) recombinant proteins of bacteriophages;    (k) recombinant proteins of RNA-phages;    (l) recombinant proteins of Qβ-phage;    (m) recombinant proteins of GA-phage;    (n) recombinant proteins of fr-phage;    (o) recombinant proteins of AP 205-phage;    (p) recombinant proteins of Ty; and    (q) fragments of any of the recombinant proteins from (a) to (p).    
     
     
         84 . The method of  claim 83 , wherein said virus-like particle is the Hepatitis B virus core protein.  
     
     
         85 . The method of  claim 83 , wherein said virus-like particle is the BK virus VP 1 protein.  
     
     
         86 . The method of  claim 72 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.  
     
     
         87 . The method of  claim 86 , wherein said RNA-phage is selected from the group consisting of: 
 (a) bacteriophage Qβ;    (b) bacteriophage R17;    (c) bacteriophage fr;    (d) bacteriophage GA;    (e) bacteriophage SP;    (f) bacteriophage MS2;    (g) bacteriophage M11;    (h) bacteriophage MX1;    (i) bacteriophage NL95;    (k) bacteriophage f2;    (l) bacteriophage PP7; and    (m) bacteriophage AP205.    
     
     
         88 . The method of  claim 72 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage Qβ.  
     
     
         89 . The method of  claim 72 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage AP 205.  
     
     
         90 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence: 
 5′X 1 X 2 CGX 3 X 4  3′   wherein X 1 , X 2 , X 3 , and X 4  are any nucleotide.    
     
     
         91 . The method of  claim 90 , wherein at least one of said nucleotide X 1 , X 2 , X 3 , and X 4  has a phosphate backbone modification.  
     
     
         92 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence selected from the group consisting of: 
 (a) TCCATGACGTTCCTGAATAAT;    (b) TCCATGACGTTCCTGACGTT;    (c) GGGGTCAACGTTGAGGGGG;    (d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and    (e) “dsCyCpG-253” as described in Table 1.    
     
     
         93 . The method of  claim 92 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         94 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide is palindromic.  
     
     
         95 . The method of  claim 94 , wherein said palindromic unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence GGGGTCAACGTTGAGGGGG.  
     
     
         96 . The method of  claim 95 , wherein said palindromic unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         97 . The method of  claim 72 , wherein said immunostimulatory substance is non-covalently bound to said virus-like particle.  
     
     
         98 . The method of  claim 72 , wherein said virus-like particle is produced in a bacterial expression system.  
     
     
         99 . The method of  claim 72 , wherein said virus-like particle is produced in a yeast expression system.  
     
     
         100 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide is non-covalently bound to said virus-like particle.  
     
     
         101 . The method of  claim 72 , wherein said immunostimulatory substance is packaged, preferably enclosed by said virus-like particle.  
     
     
         102 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide is packaged, preferably enclosed by said virus-like particle.  
     
     
         103 . The method of  claim 76 , wherein said immunostimulatory nucleic acid is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site  
     
     
         104 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.  
     
     
         105 . The method of  claim 104 , wherein said oligonucleotide binding site is a non-naturally occurring oligonucleotide binding site.  
     
     
         106 . The method of  claim 104 , wherein said virus-like particle site comprises an arginine-rich repeat.  
     
     
         107 . The method of  claim 76 , wherein said immunostimulatory nucleic acid contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         108 . The method of  claim 80 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.  
     
     
         109 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 100,000 nucleotides.  
     
     
         110 . The method of  claim 109 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 2000 nucleotides.  
     
     
         111 . The method of  claim 110 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 2000 nucleotides.  
     
     
         112 . The method of  claim 111 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 300 nucleotides.  
     
     
         113 . The method of  claim 112 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises 20 to 100 nucleotides.  
     
     
         114 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 2000 nucleotides.  
     
     
         115 . The method of  claim 114 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 1000 nucleotides.  
     
     
         116 . The method of  claim 115 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 500 nucleotides.  
     
     
         117 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a recombinant oligonucleotide.  
     
     
         118 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a genomic oligonucleotide.  
     
     
         119 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a synthetic oligonucleotide.  
     
     
         120 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a plasmid-derived oligonucleotide.  
     
     
         121 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a single-stranded oligonucleotide.  
     
     
         122 . The method of  claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a double-stranded oligonucleotide.  
     
     
         123 . The method of  claim 73 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond.  
     
     
         124 . The method of  claim 73 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond, and wherein said covalent bond is a non-peptide bond.  
     
     
         125 . The method of  claim 73 , wherein said at least one antigen or antigenic determinant is fused to said virus-like particle.  
     
     
         126 . The method of  claim 73 , wherein said antigen or antigenic determinant further comprises at least one second attachment site selected from the group consisting of: 
 (a) an attachment site not naturally occurring with said antigen or antigenic determinant; and    (b) an attachment site naturally occurring with said antigen or antigenic determinant.    
     
     
         127 . The method of  claim 73 , further comprising an amino acid linker, wherein said amino acid linker comprises, or alternatively consists of, said second attachment site.  
     
     
         128 . The method of  claim 73 , wherein said antigen is selected from the group consisting of: 
 (a) polypeptides;    (b) carbohydrates;    (c) steroid hormones; and    (d) organic molecules.    
     
     
         129 . The method of  claim 128 , wherein said antigen is an organic molecule.  
     
     
         130 . The method of  claim 129 , wherein said organic molecule is selected from the group consisting of: 
 (a) codeine;    (b) fentanyl;    (c) heroin;    (d) morphium;    (e) amphetamine;    (f) cocaine;    (g) methylenedioxymethamphetamine;    (h) methamphetamine;    (i) methylphenidate;    (j) nicotine;    (k) LSD;    (l) mescaline;    (m) psilocybin; and    (n) tetrahydrocannabinol.    
     
     
         131 . The method of  claim 73 , wherein said antigen is a recombinant antigen.  
     
     
         132 . The method of  claim 73 , wherein said antigen is derived from the group consisting of: 
 (a) viruses;    (b) bacteria;    (c) parasites;    (d) prions;    (e) tumors;    (f) self-molecules;    (g) non-peptidic hapten molecules    (h) allergens; and    (i) hormones.    
     
     
         133 . The method of  claim 132 , wherein said antigen is a tumor antigen.  
     
     
         134 . The method of  claim 133 , wherein said tumor antigen is selected from the group consisting of: 
 (a) Her2;    (b) GD2;    (c) EGF-R;    (d) CEA;    (e) CD52;    (f) CD21;    (g) human melanoma protein gp100;    (h) human melanoma protein melan-A/MART-1;    (i) tyrosinase;    (j) NA17-A nt protein;    (k) MAGE-3 protein;    (l) p53 protein;    (m) HPV16 E7 protein; and    (m) antigenic fragments of any of the tumor antigens from (a) to (m).    
     
     
         135 . The method of  claim 73 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.  
     
     
         136 . The method of  claim 135 , wherein said virus-like particle is the Hepatitis B virus core protein.  
     
     
         137 . The method of  claim 135 , wherein said virus-like particle is the BK virus VP1 protein.  
     
     
         138 . The method of  claim 73 , wherein said antigen is a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are linked directly or by way of a linking sequence.  
     
     
         139 . The method of  claim 138 , wherein said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.  
     
     
         140 . The method of  claim 138 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.  
     
     
         141 . The method of  claim 138 , wherein said virus-like particle is the Hepatitis B virus core protein.  
     
     
         142 . The method of  claim 141 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein.  
     
     
         143 . The method of  claim 142 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein by way of a linking sequence.  
     
     
         144 . The method of  claim 138 , wherein said virus-like particle is a BK virus VP1 protein.  
     
     
         145 . The method of  claim 144 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein.  
     
     
         146 . The method of  claim 145 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein by way of a linking sequence.  
     
     
         147 . The method of  claim 72 , wherein said immune response is an enhanced B cell response.  
     
     
         148 . The method of  claim 72 , wherein said immune response is an enhanced T cell response.  
     
     
         149 . The method of  claim 148 , wherein said T cell response is a CTL response.  
     
     
         150 . The method of  claim 148 , wherein said T cell response is a Th cell response.  
     
     
         151 . The method of  claim 150 , wherein said Th cell response is a Th1 cell response.  
     
     
         152 . The method of  claim 72 , wherein said animal is a mammal.  
     
     
         153 . The method of  claim 152 , wherein said mammal is a human.  
     
     
         154 . The method of  claim 72 , wherein said composition is introduced into said animal subcutaneously, intramuscularly, intravenously, intranasally or directly into the lymph node.  
     
     
         155 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises: 
 (a) incubating said virus-like particle with said immunostimulatory substance;    (b) adding RNase; and    (c) purifying said composition.    
     
     
         156 . The method of  claim 155 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of: 
 (a) ribonucleic acids;    (b) deoxyribonucleic acids;    (c) chimeric nucleic acids; and    (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).    
     
     
         157 . The method of  claim 156 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.  
     
     
         158 . The method of  claim 156 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) unmethylated CpG-containing oligonucleotides; and    (b) oligonucleotides free of unmethylated CpG motifs.    
     
     
         159 . The method of  claim 155 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.  
     
     
         160 . The method of  claim 155 , wherein said virus-like particle is produced in a bacterial expression system.  
     
     
         161 . The method of  claim 155 , wherein said RNase is RNase A.  
     
     
         162 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises: 
 (a) incubating said virus-like particle with RNase;    (b) adding said immunostimulatory substance; and    (c) purifying said composition.    
     
     
         163 . The method of  claim 162 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of: 
 (a) ribonucleic acids;    (b) deoxyribonucleic acids;    (c) chimeric nucleic acids; and    (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).    
     
     
         164 . The method of  claim 163 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.  
     
     
         165 . The method of  claim 163 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) unmethylated CpG-containing oligonucleotides; and    (b) oligonucleotides free of unmethylated CpG motifs.    
     
     
         166 . The method of  claim 162 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.  
     
     
         167 . The method of  claim 162 , wherein said virus-like particle is produced in a bacterial expression system.  
     
     
         168 . The method of  claim 162 , wherein said RNase is RNase A.  
     
     
         169 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises: 
 (a) disassembling said virus-like particle;    (b) adding said immunostimulatory substance; and    (c) reassembling said virus-like particle.    
     
     
         170 . The method of  claim 169 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of: 
 (a) ribonucleic acids;    (b) deoxyribonucleic acids;    (c) chimeric nucleic acids; and    (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).    
     
     
         171 . The method of  claim 170 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.  
     
     
         172 . The method of  claim 170 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) unmethylated CpG-containing oligonucleotides; and    (b) oligonucleotides free of unmethylated CpG motifs.    
     
     
         173 . The method of  claim 169 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.  
     
     
         174 . The method of  claim 169  further comprising removing nucleic acids of said disassembled virus-like particle.  
     
     
         175 . The method of  claim 169  further comprising purifying said composition after reassembly (c).  
     
     
         176 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises: 
 (a) incubating said virus-like particle with solutions comprising metal ions capable of hydrolizing the nucleic acids of said virus-like particle;    (b) adding said immunostimulatory substance; and    (c) purifying said composition.    
     
     
         177 . The method of  claim 176 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of: 
 (a) ribonucleic acids;    (b) deoxyribonucleic acids;    (c) chimeric nucleic acids; and    (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).    
     
     
         178 . The method of  claim 177 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.  
     
     
         179 . The method of  claim 177 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of: 
 (a) unmethylated CpG-containing oligonucleotides; and    (b) oligonucleotides free of unmethylated CpG motifs.    
     
     
         180 . The method of  claim 176 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.  
     
     
         181 . The method of  claim 176 , wherein said metal ions are selected from the group consisting of: 
 (a) zinc (Zn) ions;    (b) copper (Cu) ions;    (c) iron (Fe) ions; and    (d) any mixtures of at least one ion of (a), (b) and/or (c).    
     
     
         182 . A vaccine comprising an immunologically effective amount of the composition of  claim 1  together with a pharmaceutically acceptable diluent, carrier or excipient.  
     
     
         183 . The vaccine of  claim 182  further comprising an adjuvant.  
     
     
         184 . A method of immunizing or treating an animal comprising administering to said animal an immunologically effective amount of the vaccine of  claim 182 .  
     
     
         185 . The method of  claim 184 , wherein said animal is a mammal.  
     
     
         186 . The method of  claim 185 , wherein said mammal is a human.  
     
     
         187 . A vaccine comprising an immunologically effective amount of the composition of  claim 2  together with a pharmaceutically acceptable diluent, carrier or excipient.  
     
     
         188 . The vaccine of  claim 187  further comprising an adjuvant.  
     
     
         189 . A method of immunizing or treating an animal comprising administering to said animal an immunologically effective amount of the vaccine of  claim 187 .  
     
     
         190 . The method of  claim 189 , wherein said animal is a mammal.  
     
     
         191 . The method of  claim 190 , wherein said mammal is a human.  
     
     
         192 . A method of immunizing or treating an animal comprising priming a T cell response in said animal by administering an immunologically effective amount of the vaccine of  claim 182 .  
     
     
         193 . The method of  claim 192 , further comprising the step of boosting the immune response in said animal.  
     
     
         194 . The method of  claim 193 , wherein said boosting is effected by administering an immunologically effective amount of a vaccine of  claim 182  or an immunologically effective amount of a heterologous vaccine.  
     
     
         195 . The method of  claim 194 , wherein said heterologous vaccine is a DNA vaccine.  
     
     
         196 . A method of immunizing or treating an animal comprising boosting a T cell response in said animal by administering an immunologically effective amount of the vaccine of  claim 182 .  
     
     
         197 . The method of  claim 196 , further comprising the step of priming a T cell response in said animal.  
     
     
         198 . The method of  claim 197 , wherein said priming is effected by administering an immunologically effective amount of a vaccine of  claim 182  or an immunologically effective amount of a heterologous vaccine.  
     
     
         199 . The method of  claim 198 , wherein said heterologous vaccine is a DNA vaccine.  
     
     
         200 . A method of immunizing or treating an animal comprising priming a T cell response in said animal by administering an immunologically effective amount of the vaccine of  claim 187 .  
     
     
         201 . The method of  claim 200  further comprising the step of boosting the immune response in said animal.  
     
     
         202 . The method of  claim 201 , wherein said boosting is effected by administering an immunologically effective amount of a vaccine of  claim 187  or an immunologically effective amount of a heterologous vaccine.  
     
     
         203 . The method of  claim 202 , wherein said heterologous vaccine is a DNA vaccine or a viral vaccine or a canery pox vaccine.  
     
     
         204 . A method of immunizing or treating an animal comprising boosting a T cell response in said animal by administering an immunologically effective amount of the vaccine of  claim 187 .  
     
     
         205 . The method of  claim 204 , further comprising the step of priming a T cell response in said animal.  
     
     
         206 . The method of  claim 205 , wherein said priming is effected by administering an immunologically effective amount of a vaccine of  claim 187  or an immunologically effective amount of a heterologous vaccine.  
     
     
         207 . The method of  claim 206 , wherein said heterologous vaccine is a DNA vaccine or a viral vaccine or a canery pox vaccine.

Join the waitlist — get patent alerts

Track US2003099668A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.