Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
Abstract
The invention relates to the finding that virus like particles (VLPs) can be loaded with immunostimulatory substances, in particular with DNA oligonucleotides containing non-methylated C and G (CpGs). Such CpG-VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses. The immune response against antigens optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself. In addition, the T cell responses against both the VLPs and antigens are especially directed to the Th1 type. Antigens attached to CpG-loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.
Claims
exact text as granted — not AI-modifiedWhat is claimed is:
1 . A composition for enhancing an immune response in an animal comprising:
(a) a virus-like particle; and (b) an immunostimulatory substance; wherein said immunostimulatory substance is bound to said virus-like particle.
2 . The composition of claim 1 further comprising at least one antigen, wherein said antigen is bound to said virus-like particle.
3 . The composition of claim 1 , wherein said immunostimulatory substance is a toll-like receptor activating substance.
4 . The composition of claim 1 , wherein said immunostimulatory substance is a cytokine secretion inducing substance.
5 . The composition of claim 3 , wherein said toll-like receptor activating substance is selected from the group consisting of, or alternatively consists essentially of:
(a) immunostimulatory nucleic acids; (b) peptidoglycans; (c) lipopolysaccharides; (d) lipoteichonic acids; (e) imidazoquinoline compounds; (f) flagellines; (g) lipoproteins; (h) immunostimulatory organic molecules; (i) unmethylated CpG-containing oligonucleotides; and (j) any mixtures of at least one substance of (a), (b), (c), (d), (e), (f), (g), (h) and/or (i).
6 . The composition of claim 5 , wherein said immunostimulatory nucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
7 . The composition of claim 6 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.
8 . The composition of claim 6 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and (b) oligonucleotides free of unmethylated CpG motifs.
9 . The composition of claim 1 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
10 . The composition of claim 1 , wherein said virus-like particle lacks a lipoprotein-containing envelope.
11 . The composition of claim 1 , wherein said virus-like particle is a recombinant virus-like particle.
12 . The composition of claim 11 , wherein said virus-like particle is selected from the group consisting of:
(a) recombinant proteins of Hepatitis B virus; (b) recombinant proteins of measles virus; (c) recombinant proteins of Sinbis virus; (d) recombinant proteins of Rotavirus; (e) recombinant proteins of Foot-and-Mouth-Disease virus; (f) recombinant proteins of Retrovirus; (g) recombinant proteins of Norwalk virus; (h) recombinant proteins of human Papilloma virus; (i) recombinant proteins of BK virus; (j) recombinant proteins of bacteriophages; (k) recombinant proteins of RNA-phages; (1) recombinant proteins of Qβ-phage; (m) recombinant proteins of GA-phage (n) recombinant proteins of fr-phage; (o) recombinant proteins of AP 205-phage; (p) recombinant proteins of Ty; and (q) fragments of any of the recombinant proteins from (a) to (p).
13 . The composition of claim 12 , wherein said virus-like particle is the Hepatitis B virus core protein.
14 . The composition of claim 12 , wherein said virus-like particle is the BK virus VP 1 protein.
15 . The composition of claim 1 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.
16 . The composition of claim 15 , wherein said RNA-phage is selected from the group consisting of:
(a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h) bacteriophage MX1; (i) bacteriophage NL95; (k) bacteriophage f2; (1) bacteriophage PP7; and (m) bacteriophage AP205.
17 . The composition of claim 1 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage Qβ.
18 . The composition of claim 1 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage AP 205.
19 . The composition of claim 9 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence:
X 1 X 2 CGX 3 X 4 3′ wherein X 1 , X 2 , X 3 , and X 4 are any nucleotide.
20 . The composition of claim 19 , wherein at least one of said nucleotide X 1 , X 2 , X 3 , and X 4 has a phosphate backbone modification.
21 . The composition of claim 9 , wherein said unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence selected from the group consisting of:
(a) TCCATGACGTTCCTGAATAAT; (b) TCCATGACGTTCCTGACGTT; (c) GGGGTCAACGTTGAGGGGG; (d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and (e) “dsCyCpG-253” as described in Table 1.
22 . The composition of claim 21 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
23 . The composition of claim 9 , wherein said unrmethylated CpG-containing oligonucleotide is palindromic.
24 . The composition of claim 23 , wherein said palindromic unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence GGGGTCAACGTTGAGGGGG.
25 . The composition of claim 24 , wherein said palindromic unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
26 . The composition of claim 1 , wherein said immunostimulatory substance is non-covalently bound to said virus-like particle.
27 . The composition of claim 9 , wherein said unmethylated CpG-containing oligonucleotide is non-covalently bound to said virus-like particle.
28 . The composition of claim 5 , wherein said immunostimulatory nucleic acid is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.
29 . The composition of claim 9 , wherein said unmethylated CpG-containing oligonucleotide is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.
30 . The composition of claim 29 , wherein said oligonucleotide binding site is a non-naturally occurring oligonucleotide binding site.
31 . The composition of claim 29 , wherein said virus-like particle site comprises an arginine-rich repeat.
32 . The composition of claim 5 , wherein said immunostimulatory nucleic acid contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
33 . The composition of claim 9 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
34 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 100,000 nucleotides.
35 . The composition of claim 34 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 2000 nucleotides.
36 . The composition of claim 35 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 2000 nucleotides.
37 . The composition of claim 36 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 300 nucleotides.
38 . The composition of claim 37 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises 20 to 100 nucleotides.
39 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 2000 nucleotides.
40 . The composition of claim 39 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 1000 nucleotides.
41 . The composition of claim 40 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 500 nucleotides.
42 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a recombinant oligonucleotide.
43 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a genomic oligonucleotide.
44 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a synthetic oligonucleotide.
45 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a plasmid-derived oligonucleotide.
46 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a single-stranded oligonucleotide.
47 . The composition of claim 5 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a double-stranded oligonucleotide.
48 . The composition of claim 2 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond.
49 . The composition of claim 2 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond, and wherein said covalent bond is a non-peptide bond.
50 . The composition of claim 2 , wherein said at least one antigen or antigenic determinant is fused to said virus-like particle.
51 . The composition of claim 2 , wherein said antigen or antigenic determinant further comprises at least one second attachment site being selected from the group consisting of:
(a) an attachment site not naturally occurring with said antigen or antigenic determinant; and (b) an attachment site naturally occurring with said antigen or antigenic determinant.
52 . The composition of claim 2 further comprising an amino acid linker, wherein said amino acid linker comprises, or alternatively consists of, said second attachment site.
53 . The composition of claim 2 , wherein said antigen is selected from the group consisting of:
(a) polypeptides; (b) carbohydrates; (c) steroid hormones; and (d) organic molecules.
54 . The composition of claim 53 , wherein said antigen is an organic molecule.
55 . The composition of claim 54 , wherein said organic molecule is selected from the group consisting of:
(a) codeine; (b) fentanyl; (c) heroin; (d) morphium; (e) amphetamine; (f) cocaine; (g) methylenedioxymethamphetamine; (h) methamphetamine; (i) methylphenidate; (j) nicotine; (k) LSD; (l) mescaline; (m) psilocybin; and (n) tetrahydrocannabinol.
56 . The composition of claim 2 , wherein said antigen is a recombinant antigen.
57 . The composition of claim 2 , wherein said antigen is derived from the group consisting of:
(a) viruses; (b) bacteria; (c) parasites; (d) prions; (e) tumors; (f) self-molecules; (g) non-peptidic hapten molecules (h) allergens; and (i) hormones.
58 . The composition of claim 57 , wherein said antigen is a tumor antigen.
59 . The composition of claim 58 , wherein said tumor antigen is selected from the group consisting of:
(a) Her2; (b) GD2; (c) EGF-R; (d) CEA; (e) CD52; (f) CD21; (g) human melanoma protein gp100; (h) human melanoma protein melan-A/MART-1; (i) tyrosinase; (j) NA 17-A nt protein; (k) MAGE-3 protein; (l) p53 protein; (m) HPV16 E7 protein; and (n) antigenic fragments of any of the tumor antigens from (a) to (m).
60 . The composition of claim 2 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.
61 . The composition of claim 60 , wherein said virus-like particle is the Hepatitis B virus core protein.
62 . The composition of claim 60 , wherein said virus-like particle is the BK virus core protein.
63 . The composition of claim 2 , wherein said antigen is a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are bound directly or by way of a linking sequence.
64 . The composition of claim 63 , wherein said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.
65 . The composition of claim 63 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.
66 . The composition of claim 63 , wherein said virus-like particle is the Hepatitis B virus core protein.
67 . The composition of claim 66 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein.
68 . The composition of claim 67 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein by way of a linking sequence.
69 . The composition of claim 63 , wherein said virus-like particle is the BK virus VP 1 protein.
70 . The composition of claim 69 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein.
71 . The composition of claim 70 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein by way of a linking sequence.
72 . A method for enhancing an immune response in an animal comprising introducing into said animal a composition comprising:
(a) a virus-like particle; and (b) an immunostimulatory substance; wherein said immunostimulatory substance is bound to said virus-like particle.
73 . The method of claim 72 , wherein said composition further comprises an antigen, wherein said antigen is bound to said virus-like particle.
74 . The method of claim 72 , wherein said immunostimulatory substance is a toll-like receptor activating substance.
75 . The method of claim 72 , wherein said immunostimulatory substance is a cytokine secretion inducing substance.
76 . The method of claim 74 , wherein said toll-like receptor activating substance is selected from the group consisting of, or alternatively consists essentially of:
(a) immunostimulatory nucleic acids; (b) peptidoglycans; (c) lipopolysaccharides; (d) lipoteichonic acids; (e) imidazoquinoline compounds; (f) flagellines; (g) lipoproteins; (h) immunostimulatory organic molecules; (i) unmethylated CpG-containing oligonucleotides; and (j) any mixtures of at least one substance of (a), (b), (c), (d), (e), (f), (g), (h) and/or (i).
77 . The method of claim 76 , wherein said immunostimulatory nucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
78 . The method of claim 77 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.
79 . The method of claim 77 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and (b) oligonucleotides free of unmethylated CpG motifs.
80 . The method of claim 72 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
81 . The method of claim 72 , wherein said virus-like particle lacks a lipoprotein-containing envelope.
82 . The method of claim 72 , wherein said virus-like particle is a recombinant virus-like particle.
83 . The method of claim 82 , wherein said virus-like particle is selected from the group consisting of:
(a) recombinant proteins of Hepatitis B virus; (b) recombinant proteins of measles virus; (c) recombinant proteins of Sinbis virus; (d) recombinant proteins of Rotavirus; (e) recombinant proteins of Foot-and-Mouth-Disease virus; (f) recombinant proteins of Retrovirus; (g) recombinant proteins of Norwalk virus; (h) recombinant proteins of human Papilloma virus; (i) recombinant proteins of BK virus; (j) recombinant proteins of bacteriophages; (k) recombinant proteins of RNA-phages; (l) recombinant proteins of Qβ-phage; (m) recombinant proteins of GA-phage; (n) recombinant proteins of fr-phage; (o) recombinant proteins of AP 205-phage; (p) recombinant proteins of Ty; and (q) fragments of any of the recombinant proteins from (a) to (p).
84 . The method of claim 83 , wherein said virus-like particle is the Hepatitis B virus core protein.
85 . The method of claim 83 , wherein said virus-like particle is the BK virus VP 1 protein.
86 . The method of claim 72 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.
87 . The method of claim 86 , wherein said RNA-phage is selected from the group consisting of:
(a) bacteriophage Qβ; (b) bacteriophage R17; (c) bacteriophage fr; (d) bacteriophage GA; (e) bacteriophage SP; (f) bacteriophage MS2; (g) bacteriophage M11; (h) bacteriophage MX1; (i) bacteriophage NL95; (k) bacteriophage f2; (l) bacteriophage PP7; and (m) bacteriophage AP205.
88 . The method of claim 72 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage Qβ.
89 . The method of claim 72 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage AP 205.
90 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence:
5′X 1 X 2 CGX 3 X 4 3′ wherein X 1 , X 2 , X 3 , and X 4 are any nucleotide.
91 . The method of claim 90 , wherein at least one of said nucleotide X 1 , X 2 , X 3 , and X 4 has a phosphate backbone modification.
92 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence selected from the group consisting of:
(a) TCCATGACGTTCCTGAATAAT; (b) TCCATGACGTTCCTGACGTT; (c) GGGGTCAACGTTGAGGGGG; (d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and (e) “dsCyCpG-253” as described in Table 1.
93 . The method of claim 92 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
94 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide is palindromic.
95 . The method of claim 94 , wherein said palindromic unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence GGGGTCAACGTTGAGGGGG.
96 . The method of claim 95 , wherein said palindromic unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
97 . The method of claim 72 , wherein said immunostimulatory substance is non-covalently bound to said virus-like particle.
98 . The method of claim 72 , wherein said virus-like particle is produced in a bacterial expression system.
99 . The method of claim 72 , wherein said virus-like particle is produced in a yeast expression system.
100 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide is non-covalently bound to said virus-like particle.
101 . The method of claim 72 , wherein said immunostimulatory substance is packaged, preferably enclosed by said virus-like particle.
102 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide is packaged, preferably enclosed by said virus-like particle.
103 . The method of claim 76 , wherein said immunostimulatory nucleic acid is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site
104 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.
105 . The method of claim 104 , wherein said oligonucleotide binding site is a non-naturally occurring oligonucleotide binding site.
106 . The method of claim 104 , wherein said virus-like particle site comprises an arginine-rich repeat.
107 . The method of claim 76 , wherein said immunostimulatory nucleic acid contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
108 . The method of claim 80 , wherein said unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
109 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 100,000 nucleotides.
110 . The method of claim 109 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 2000 nucleotides.
111 . The method of claim 110 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 2000 nucleotides.
112 . The method of claim 111 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 300 nucleotides.
113 . The method of claim 112 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises 20 to 100 nucleotides.
114 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 2000 nucleotides.
115 . The method of claim 114 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 1000 nucleotides.
116 . The method of claim 115 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 500 nucleotides.
117 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a recombinant oligonucleotide.
118 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a genomic oligonucleotide.
119 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a synthetic oligonucleotide.
120 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a plasmid-derived oligonucleotide.
121 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a single-stranded oligonucleotide.
122 . The method of claim 76 , wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a double-stranded oligonucleotide.
123 . The method of claim 73 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond.
124 . The method of claim 73 , wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond, and wherein said covalent bond is a non-peptide bond.
125 . The method of claim 73 , wherein said at least one antigen or antigenic determinant is fused to said virus-like particle.
126 . The method of claim 73 , wherein said antigen or antigenic determinant further comprises at least one second attachment site selected from the group consisting of:
(a) an attachment site not naturally occurring with said antigen or antigenic determinant; and (b) an attachment site naturally occurring with said antigen or antigenic determinant.
127 . The method of claim 73 , further comprising an amino acid linker, wherein said amino acid linker comprises, or alternatively consists of, said second attachment site.
128 . The method of claim 73 , wherein said antigen is selected from the group consisting of:
(a) polypeptides; (b) carbohydrates; (c) steroid hormones; and (d) organic molecules.
129 . The method of claim 128 , wherein said antigen is an organic molecule.
130 . The method of claim 129 , wherein said organic molecule is selected from the group consisting of:
(a) codeine; (b) fentanyl; (c) heroin; (d) morphium; (e) amphetamine; (f) cocaine; (g) methylenedioxymethamphetamine; (h) methamphetamine; (i) methylphenidate; (j) nicotine; (k) LSD; (l) mescaline; (m) psilocybin; and (n) tetrahydrocannabinol.
131 . The method of claim 73 , wherein said antigen is a recombinant antigen.
132 . The method of claim 73 , wherein said antigen is derived from the group consisting of:
(a) viruses; (b) bacteria; (c) parasites; (d) prions; (e) tumors; (f) self-molecules; (g) non-peptidic hapten molecules (h) allergens; and (i) hormones.
133 . The method of claim 132 , wherein said antigen is a tumor antigen.
134 . The method of claim 133 , wherein said tumor antigen is selected from the group consisting of:
(a) Her2; (b) GD2; (c) EGF-R; (d) CEA; (e) CD52; (f) CD21; (g) human melanoma protein gp100; (h) human melanoma protein melan-A/MART-1; (i) tyrosinase; (j) NA17-A nt protein; (k) MAGE-3 protein; (l) p53 protein; (m) HPV16 E7 protein; and (m) antigenic fragments of any of the tumor antigens from (a) to (m).
135 . The method of claim 73 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.
136 . The method of claim 135 , wherein said virus-like particle is the Hepatitis B virus core protein.
137 . The method of claim 135 , wherein said virus-like particle is the BK virus VP1 protein.
138 . The method of claim 73 , wherein said antigen is a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are linked directly or by way of a linking sequence.
139 . The method of claim 138 , wherein said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.
140 . The method of claim 138 , wherein said antigen is bound to said virus-like particle by way of a linking sequence.
141 . The method of claim 138 , wherein said virus-like particle is the Hepatitis B virus core protein.
142 . The method of claim 141 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein.
143 . The method of claim 142 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein by way of a linking sequence.
144 . The method of claim 138 , wherein said virus-like particle is a BK virus VP1 protein.
145 . The method of claim 144 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein.
146 . The method of claim 145 , wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VP1 protein by way of a linking sequence.
147 . The method of claim 72 , wherein said immune response is an enhanced B cell response.
148 . The method of claim 72 , wherein said immune response is an enhanced T cell response.
149 . The method of claim 148 , wherein said T cell response is a CTL response.
150 . The method of claim 148 , wherein said T cell response is a Th cell response.
151 . The method of claim 150 , wherein said Th cell response is a Th1 cell response.
152 . The method of claim 72 , wherein said animal is a mammal.
153 . The method of claim 152 , wherein said mammal is a human.
154 . The method of claim 72 , wherein said composition is introduced into said animal subcutaneously, intramuscularly, intravenously, intranasally or directly into the lymph node.
155 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises:
(a) incubating said virus-like particle with said immunostimulatory substance; (b) adding RNase; and (c) purifying said composition.
156 . The method of claim 155 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
157 . The method of claim 156 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.
158 . The method of claim 156 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and (b) oligonucleotides free of unmethylated CpG motifs.
159 . The method of claim 155 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
160 . The method of claim 155 , wherein said virus-like particle is produced in a bacterial expression system.
161 . The method of claim 155 , wherein said RNase is RNase A.
162 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises:
(a) incubating said virus-like particle with RNase; (b) adding said immunostimulatory substance; and (c) purifying said composition.
163 . The method of claim 162 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
164 . The method of claim 163 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.
165 . The method of claim 163 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and (b) oligonucleotides free of unmethylated CpG motifs.
166 . The method of claim 162 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
167 . The method of claim 162 , wherein said virus-like particle is produced in a bacterial expression system.
168 . The method of claim 162 , wherein said RNase is RNase A.
169 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises:
(a) disassembling said virus-like particle; (b) adding said immunostimulatory substance; and (c) reassembling said virus-like particle.
170 . The method of claim 169 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
171 . The method of claim 170 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.
172 . The method of claim 170 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and (b) oligonucleotides free of unmethylated CpG motifs.
173 . The method of claim 169 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
174 . The method of claim 169 further comprising removing nucleic acids of said disassembled virus-like particle.
175 . The method of claim 169 further comprising purifying said composition after reassembly (c).
176 . A method of producing a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance bound to said virus-like particle which comprises:
(a) incubating said virus-like particle with solutions comprising metal ions capable of hydrolizing the nucleic acids of said virus-like particle; (b) adding said immunostimulatory substance; and (c) purifying said composition.
177 . The method of claim 176 , wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids; (b) deoxyribonucleic acids; (c) chimeric nucleic acids; and (d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
178 . The method of claim 177 , wherein said ribonucleic acid is poly-(I:C) or a derivative thereof.
179 . The method of claim 177 , wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and (b) oligonucleotides free of unmethylated CpG motifs.
180 . The method of claim 176 , wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
181 . The method of claim 176 , wherein said metal ions are selected from the group consisting of:
(a) zinc (Zn) ions; (b) copper (Cu) ions; (c) iron (Fe) ions; and (d) any mixtures of at least one ion of (a), (b) and/or (c).
182 . A vaccine comprising an immunologically effective amount of the composition of claim 1 together with a pharmaceutically acceptable diluent, carrier or excipient.
183 . The vaccine of claim 182 further comprising an adjuvant.
184 . A method of immunizing or treating an animal comprising administering to said animal an immunologically effective amount of the vaccine of claim 182 .
185 . The method of claim 184 , wherein said animal is a mammal.
186 . The method of claim 185 , wherein said mammal is a human.
187 . A vaccine comprising an immunologically effective amount of the composition of claim 2 together with a pharmaceutically acceptable diluent, carrier or excipient.
188 . The vaccine of claim 187 further comprising an adjuvant.
189 . A method of immunizing or treating an animal comprising administering to said animal an immunologically effective amount of the vaccine of claim 187 .
190 . The method of claim 189 , wherein said animal is a mammal.
191 . The method of claim 190 , wherein said mammal is a human.
192 . A method of immunizing or treating an animal comprising priming a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 182 .
193 . The method of claim 192 , further comprising the step of boosting the immune response in said animal.
194 . The method of claim 193 , wherein said boosting is effected by administering an immunologically effective amount of a vaccine of claim 182 or an immunologically effective amount of a heterologous vaccine.
195 . The method of claim 194 , wherein said heterologous vaccine is a DNA vaccine.
196 . A method of immunizing or treating an animal comprising boosting a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 182 .
197 . The method of claim 196 , further comprising the step of priming a T cell response in said animal.
198 . The method of claim 197 , wherein said priming is effected by administering an immunologically effective amount of a vaccine of claim 182 or an immunologically effective amount of a heterologous vaccine.
199 . The method of claim 198 , wherein said heterologous vaccine is a DNA vaccine.
200 . A method of immunizing or treating an animal comprising priming a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 187 .
201 . The method of claim 200 further comprising the step of boosting the immune response in said animal.
202 . The method of claim 201 , wherein said boosting is effected by administering an immunologically effective amount of a vaccine of claim 187 or an immunologically effective amount of a heterologous vaccine.
203 . The method of claim 202 , wherein said heterologous vaccine is a DNA vaccine or a viral vaccine or a canery pox vaccine.
204 . A method of immunizing or treating an animal comprising boosting a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 187 .
205 . The method of claim 204 , further comprising the step of priming a T cell response in said animal.
206 . The method of claim 205 , wherein said priming is effected by administering an immunologically effective amount of a vaccine of claim 187 or an immunologically effective amount of a heterologous vaccine.
207 . The method of claim 206 , wherein said heterologous vaccine is a DNA vaccine or a viral vaccine or a canery pox vaccine.Join the waitlist — get patent alerts
Track US2003099668A1 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.