US2003049635A1PendingUtilityA1

Measurement of mutation load using the p53 gene in human cells from paraffin embedded tissues

Assignee: HOPE CITYPriority: Nov 8, 2000Filed: Nov 8, 2001Published: Mar 13, 2003
Est. expiryNov 8, 2020(expired)· nominal 20-yr term from priority
C12Q 1/6827C12Q 1/6886
52
PatentIndex Score
0
Cited by
0
References
0
Claims

Abstract

A method for determining mutation load in a somatic cell is determined by mutation analysis of the p53 gene. The p53 gene has been found to be a useful indicator of predisposition to spontaneous mutations or prior carcinogen exposure. Cells that contain mutated p53 tend to accumulate the mutant protein. Thus, DNA from a cell identified by p53 accumulation is amplified and the amplification product further analyzed for mutations in the p53 gene.

Claims

exact text as granted — not AI-modified
What is claimed is:  
     
         1 . A method for determining mutation load which comprises identifying a somatic cell that contains accumulated levels of p53, amplifying DNA of the p53 gene from such cell and determining the frequency or nature of mutations in the amplified DNA.  
     
     
         2 . The method of  claim 1 , in which the somatic cell that is identified also contains altered levels of a protein selected from the group consisting of PCNA and other proteins that are regulated by p53.  
     
     
         3 . The method of  claim 2 , wherein the protein is PCNA.  
     
     
         4 . The method of  claim 2 , wherein the protein is mdm2 or vEGF.  
     
     
         5 . The method of  claim 1 , in which the somatic cell is identified by immunohistochemical staining for p53.  
     
     
         6 . The method of  claim 2 , in which the somatic cell is identified by immunohistochemical staining for p53 and a protein selected from the group consisting of PCNA and other proteins that are regulated by p53.  
     
     
         7 . The method of  claim 1  or  2 , in which the amplification is conducted in the presence of mouse DNA or bovine serum albumin or both.  
     
     
         8 . The method of  claim 1  or  2 , wherein the DNA that is amplified is from exons 5 to 9 of the p53 gene.  
     
     
         9 . The method of  claim 1  or  2 , wherein the DNA that is amplified is at least 1 kb in size.  
     
     
         10 . The method of  claim 1  or  2 , wherein the DNA that is amplified is at least 2 kb in size.  
     
     
         11 . The method of  claim 1  or  2 , in which the amplification is conducted in the presence of mouse DNA having an average size of at least about 20 kb.  
     
     
         12 . The method of  claim 1  or  2 , in which the method is performed on a single somatic cell which is obtained by microdissection from a paraffin-embedded tissue section.  
     
     
         13 . The method of  claim 12 , in which the tissue section is fixed with ethanol.  
     
     
         14 . The method of  claim 12  in which the tissue section is subjected to steam heating in the presence of EDTA to facilitate unmasking of antigen sites.  
     
     
         15 . The method of  claim 1  or  2 , in which the amplification step utilizes two different DNA polymerases.  
     
     
         16 . The method of  claim 15 , in which the two DNA polymerases are Platinum Taq DNA polymerase High Fidelity (Taq/GB-D) and Platinum Taq DNA polymerase.  
     
     
         17 . The method of  claim 11 , in which amplification comprises use of primers of the sequence  
       
         
           
                 
                 
                 
               
                     
                 
                   GCCGTCTTCCAGTTGCTTTATCTGTTCACT with either 
                   (SEQ. ID. NO. 1) 
                     
                 
                     
                 
                   CCTGATGGCAAATGCCCCAATTGCAGGTAA or 
                   (SEQ. ID. NO. 2) 
                 
                     
                 
                   GTCAAGTAGCATCTGTATCAGGCAAAGTCATAG. 
                   (SEQ. ID. NO. 3) 
                 
                     
                 
             
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         18 . The method of  claim 17 , which further comprises use of primers of the sequence  
       
         
           
                 
                 
               
                     
                 
                   GCCGTCTTCCAGTTGCTTTATCTGTTCACT 
                   (SEQ. ID. NO. 1) 
                 
                   and 
                 
                     
                 
                   CCTGATGGCAAATGCCCCAATTGCAGGTAA. 
                   (SEQ. ID. NO. 2) 
                 
                     
                 
             
                
                
                
                
                
                
               
            
           
         
       
     
     
         19 . The method of  claim 17 , which further comprises use of primers of the sequence  
       
         
           
                 
                 
                 
               
                     
                 
                   GCCGTCTTCCAGTTGCTTTATCTGTTCACT 
                   (SEQ. ID. NO.1) and 
                     
                 
                     
                 
                   GTCAAGTAGCATCTGTATCAGGCAAAGTCATAG 
                   (SEQ. ID. NO.3). 
                 
                     
                 
             
                
                
                
                
                
               
            
           
         
       
     
     
         20 . The method of  claim 12 , in which the paraffin-embedded tissue section is prepared from a sample that originated from a patient that is at risk for developing a cancerous condition.  
     
     
         21 . The method of  claim 12 , in which the paraffin-embedded tissue section is prepared from a sample that originated from a patient that is currently receiving treatment for a present cancer condition.  
     
     
         22 . The method of  claim 21 , in the treatment is radiation treatment.  
     
     
         23 . The method of  claim 21 , in the treatment is cytotoxic drug treatment.  
     
     
         24 . The method of  claim 21 , in the treatment is gene therapy treatment.  
     
     
         25 . The method of  claim 1  or  2 , in which the frequency or nature of mutations is determined by sequence analysis which utilizes one or more of  
       
         
           
                 
                 
                 
               
                     
                     
                 
                     
                   TGCCCTGACTTTCAACTCTGTCTC, 
                   (SEQ. ID. NO. 5) 
                 
                     
                     
                 
                     
                   AGGGTCCCCAGGCCTCTGAT, 
                   (SEQ. ID. NO. 6) 
                 
                     
                     
                 
                     
                   GGCCACTGACAACCACCCTTAA, 
                   (SEQ. ID. NO. 7) 
                 
                     
                     
                 
                     
                   AGGTCTCCCCAAGGCGCACT, 
                   (SEQ. ID. NO. 8) 
                 
                     
                     
                 
                     
                   GGGGCACAGCAGGCCAGTGT, 
                   (SEQ. ID. NO. 9) 
                 
                     
                     
                 
                     
                   GGAGAGACCGGCGCACAGA, or 
                   (SEQ. ID. NO. 10) 
                 
                     
                     
                 
                     
                   CGGCATTTTGAGTGTTAGACTGGA 
                   (SEQ. ID. NO. 11) 
                 
                     
                   as primers.

Join the waitlist — get patent alerts

Track US2003049635A1 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.