Antisense human fucosyltransferase sequences and methods of use thereof

Abstract

The present invention provides oligonucleotides that hybridizes to a nucleic acid that encodes a fucosyltransferase (FUT). The fucosyltransferase is preferably FUT3 or FUT6, along with vectors that contain the same. Pharmaceutical formulations that contain such oligonucleotides or vectors are also provided, along with methods of use thereof in the treatment of cancer.

We claim:  
     
         1 . An oligonucleotide that hybridizes to a nucleic acid that encodes a fucosyltransferase, wherein said fucosyltransferase is selected from the group consisting of FUT3 and FUT6.  
     
     
         2 . An oligonucleotide according to  claim 1 , wherein said antisense oligonucleotide hybridizes to a nucleic acid that encodes FUT3.  
     
     
         3 . An oligonucleotide according to  claim 1 , wherein said antisense oligonucleotide hybridizes to a nucleic acid that encodes FUT6.  
     
     
         4 . An oligonucleotide according to  claim 1 , which oligonucleotide activates RNase H.  
     
     
         5 . An oligonucleotide according to  claim 1 , which oligonucleotide does not activate RNase H.  
     
     
         6 . An oligonucleotide according to  claim 1  selected from the group consisting of FUT3 antisense oligonucleotides having the sequence:  
       
         
           
                 
                 
               
                     
                     
                 
                     
                   AGGCCATGGCAGGTTTCCTG (SEQ ID NO:1); 
                 
                     
                     
                 
                     
                   AACTGAAGATCTACAAAAGA (SEQ ID NO:2); 
                 
                     
                     
                 
                     
                   ACCAAGGTTCTGGAAAGAGA (SEQ ID NO:2); 
                 
                     
                     
                 
                     
                   TGTAGGTCACCTGAGTGTGA (SEQ ID NO:4); 
                 
                     
                     
                 
                     
                   GCTGCACCCAGGGGATCCAT (SEQ ID NO:5); 
                 
                     
                     
                 
                     
                   TCTCGTAGTTGCTTCTGCTG (SEQ ID NO:6); 
                 
                     
                     
                 
                     
                   GAGCGAGGCCGCAGCGTCTC (SEQ ID NO:7); 
                 
                     
                     
                 
                     
                   ATCAGCCAGAACCATCACTC (SEQ ID NO:8); 
                 
                     
                     
                 
                     
                   ACCTGTACCCTATAAGTGGT (SEQ ID NO:9); 
                 
                     
                     
                 
                     
                   GATAACTTACCTGGAGAGGC (SEQ ID NO:10); and 
                 
                     
                     
                 
                     
                   TTAGGGTTGGACATGATATC (SEQ ID NO:11). 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         7 . An oligonucleotide according to  claim 1  selected from the group consisting of FUT6 antisense oligonucleotides having the sequence:  
       
         
           
                 
                 
               
                     
                     
                 
                     
                   CCCACTCCTGCAGGGCAGTG (SEQ ID NO:12); 
                 
                     
                     
                 
                     
                   GGGTCTTCACCACTGGAGAG (SEQ ID NO:13); 
                 
                     
                     
                 
                     
                   AGTGAAAAGGCTGACCTGAA (SEQ ID NO:14); 
                 
                     
                     
                 
                     
                   TGGATGCCCGTGACACTGGG (SEQ ID NO:15); 
                 
                     
                     
                 
                     
                   GCCGGGCCCAGGGGATCCAT (SEQ ID NO:16); 
                 
                     
                     
                 
                     
                   CACCCAGATCCAGCGTCCCA (SEQ ID NO:17); 
                 
                     
                     
                 
                     
                   ATCTCCTGACCTTGTGATCC (SEQ ID NO:18); 
                 
                     
                     
                 
                     
                   GATCTCCTGACCTAGGAAGA (SEQ ID NO:19); 
                 
                     
                     
                 
                     
                   TTCTCACTCAGTTGGCCCAT (SEQ ID NO:20); 
                 
                     
                     
                 
                     
                   CCAACCACCACACCTGTCAT (SEQ ID NO:21); and 
                 
                     
                     
                 
                     
                   GGACGAGTAACAGCTGGATT (SEQ ID NO:22). 
                 
                     
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         8 . A pharmaceutical formulation comprising an antisense oligonucleotide according to  claim 1  in a pharmaceutically acceptable carrier.  
     
     
         9 . A method of treating a subject afflicted with cancer, comprising administering to said subject an antisense oligonucleotide according to  claim 1  in an amount effective to treat said cancer.  
     
     
         10 . A method according to  claim 9 , wherein said cancer is a carcinoma.  
     
     
         11 . A method according to  claim 9 , wherein said cancer is selected from the group consisting of colon, pancreatic, ovarian, gastric, breast, lung, hepatocellular, prostate, bladder, renal, and uterine cancer.  
     
     
         12 . A nucleic acid encoding an antisense oligonucleotide that hybridizes to a nucleic acid that encodes a fucosyltransferase, wherein said fucosyltransferase is selected from the group consisting of FUT3 and FUT6.  
     
     
         13 . A nucleic acid according to  claim 12 , wherein said nucleic acid is selected from the group consisting of DNA and RNA.  
     
     
         14 . A vector that contains and expresses a nucleic acid according to  claim 12 .  
     
     
         15 . A pharmaceutical formulation comprising a vector according to  claim 14  in a pharmaceutically acceptable carrier.  
     
     
         16 . A method of treating a subject afflicted with cancer, comprising administering to said subject a vector according to  claim 14  in an amount effective to treat said cancer.  
     
     
         17 . A method according to  claim 16 , wherein said cancer is a carcinoma.  
     
     
         18 . A method according to  claim 16 , wherein said cancer is selected from the group consisting of colon, pancreatic, ovarian, gastric, breast, lung, hepatocellular, prostate, bladder, renal, and uterine cancer.  
     
     
         19 . A cell that contains and expresses a nucleic acid according to  claim 12 .  
     
     
         20 . An oligonucleotide according to claim having the sequence:  
       
         
           
                 
               
                     
                 
                   GCTTGGCTGCACCCAGGGGATC (SEQ ID NO:23) (FUT3 3.5). 
                 
                     
                 
             
                
                
                
               
            
           
         
       
     
     
         21 . An oligonucleotide according to  claim 1  having the sequence:  
       
         
           
                 
                 
               
                     
                 
                   CTCTGCCGCTCCTGGACACTGCTGC 
                   (SEQ ID NO:24) (FUT 6 
                 
                     
                   LEADER).