Gene therapy of diseases associated with the immune system, using a cell-specific active compound which is regulated by the cell cycle

Abstract

A DNA sequence is described for the gene therapy of diseases associated with the immune system. In its essential elements, the DNA sequence is composed of an activator sequence, a promoter module and a gene for the active substance. The activator sequence is activated in a cell-specific or virus-specific manner and this activation is regulated by the promoter module in a cell cycle-specific manner. The choice of activator sequence and active substance depends on the indication area. The DNA sequence is inserted into a viral or non-viral vector which is supplemented by a ligand having affinity for the target cell. Depending on the choice of activator sequence and active substance, the following can be treated by administering the DNA sequence: defective formation of blood cells autoimmune diseases and allergies and, in addition, rejection reactions against transplanted organs chronic arthritis viral and parasitic infections and, in addition, prophylaxis of viral, bacterial and parasitic infections, and leukaemias.

1 . An active compound for the prophylaxis or therapy of diseases which are associated with the immune system, which active compound contains a DNA construct which is composed of an activator sequence, a cell cycle-regulated promoter module and a DNA sequence for the active substance.  
     
     
         2 . The active compound as claimed in  claim 1 , in which the promoter module possess the CDE-CHR-Inr elements and contains positions ≦−20 to ≧+30 of the cdc25C promoter region (nucleotide sequence: GGCTGGCGGAAGGTTTGAATGGTCAACGCCTGCGGCTGTTGATATCTTG), where CDE constitutes the cell cycle-dependent element (nucleotide sequence: TGGCGG), CHR constitutes the cell cycle gene homology region (nucleotide sequence: GTTTGAA) and Inr constitutes the initiation site (position +1) and also the neighboring sequences which are important for initiation.  
     
     
         3 . The active compound as claimed in  claim 1 , containing an activator sequence (promoter sequence or enhancer sequence) which is regulated by transcription factors which are formed to a particularly great degree in cells of the hematopoietic system, in synovial cells, in virus-infected cells, in parasites, in macrophages, in lymphocytes or in leukemia cells.  
     
     
         4 . The active compound as claimed in  claim 3 , containing the CMV promoter sequence, the CMV enhancer sequence or the Sv40 promoter sequence.  
     
     
         5 . The active compound as claimed in  claim 3 , for the therapy of an inadequate formation of blood cells, in which the activator sequence constitutes the promoter sequence of a gene for a cytokine, or of the receptor for the cytokine, which is activated in undifferentiated, or only slightly differentiated, cells of the hematopoietic system or in directly adjacent stroma cells.  
     
     
         6 . The active compound as claimed in  claim 5 , containing the promoter sequence for stem cell factor, interleukin (IL)-1α, IL-1β, IL-3, IL-6, LIF or granulocyte macrophage colony stimulating factor, or the promoter sequence of the receptors for stem cell factor, IL-1 or IL-3, IL-6, LIF or GM-CSF, or the promoter sequence for interferon regulatory factor 1 (IRF-1).  
     
     
         7 . The active compound as claimed in  claim 3 , for the therapy of autoimmune diseases, allergies and inflammations, and for preventing organ rejections, in which the activator sequence constitutes the promoter sequence of a gene for a protein which is formed to an increased extent when macrophages or lymphocytes are activated.  
     
     
         8 . The active compound as claimed in  claim 7 , containing the promoter sequence for interleukin (IL)-1α or IL-1β, IL-1 receptor, IL-2, IL-2 receptor, inferon γ, IL-3, IL-3 receptor, IL-4, IL-4 receptor, IL-5, IL-6, interferon regulatory factor 1, IFN-γ responsive promoter, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, granulocyte macrophage colony stimulating factor (GM-CSF), GM-CSF receptor, granulocyte colony stimulating factor (G-CSF), macrophage colony stimulating factor receptor, macrophage scavenger type I or type II receptor or leukemia-inhibiting factor (LIF), LFA-1, MAC-1 or p150.95.  
     
     
         9 . The active compound as claimed in  claim 1  for the therapy of arthritis, containing an activator sequence (promoter sequence or enhancer sequence) which is regulated by transcription factors which are formed in synovial cells or inflammatory cells.  
     
     
         10 . The active compound as claimed in  claim 9  containing the promoter sequence for a matrix metalloproteinase gene (MMP), a tissue inhibitor of metalloproteinases (TIMP) gene, or for the M-CSF receptor or macrophage scavenger type I or type II receptor.  
     
     
         11 . The active compound as claimed in  claim 10 , containing the promoter sequence for the MMP-1 gene, the MMP-2 gene, the MMP-3 gene, the MMP-9 gene, the TIMP-1 gene or the TIMP-2 gene.  
     
     
         12 . The active compound as claimed in  claim 10 , containing the promoter sequence for the tissue inhibitor of metalloproteinase-3 gene, containing promoteractive DNA fragments, containing position ≦−463 to ≧−2 of the following nucleotide sequence:  
       
         
           
                 
                 
                 
               
                     
                 
                   −500 
                   ATGGCTTCCC ATATCCCAGA GAGTAAGAAC CAGAGAGAGA GAGAGAAAGA GAGAGAGTTT 
                     
                 
                     
                 
                   −440 
                   GGGTCTTTCT CCTCTGTGCC TGCTCTCTCC AGAGAAACTG GAGGGGTAGC AGTTAGCATT 
                 
                     
                 
                   −380 
                   CCCCCGCTGG TTCCACCAAG CACAGTCAAG GTCTCTAGGA CATGGCCACC CCTCACCTGT 
                 
                     
                 
                   320 
                   GGAAGCGGTC CTGCTGGGGT GGGTGGGTGT TAGT GGTTC TGGTTTGGGT CAGAGACACC 
                 
                     
                 
                     
                                      NF1 
                 
                     
                 
                   −260 
                   CAGTGGCCCA GG TGG GCGTG GG GCCA GGGC GCAGACGAGA AGGGGCACGA GGGCTCCGCT 
                 
                     
                 
                   −200 
                   CCGAGGACCC AGCGGCAAGC ACCGGTCCCG GGCGCGCCCC AGCCCACCCA CTCGCGTGCC 
                 
                     
                 
                     
                                                               Sp1      Sp1 
                 
                     
                 
                   −140 
                   CACGGCGGCA TTATTCCCTA TAAGGATCTG AACGATCCGG  GGGCGG C CCC   
                   GCCCCGTTAC 
                 
                     
                 
                     
                                  Sp1                          C/EBP 
                 
                     
                 
                   −80 
                   CCCTTGCCCC CGGC CCCGCC  CCCTTTTTGG AGGGCCGATG AGGTAATGCG GCTCTGCCAT 
                 
                     
                 
                     
                                 Sp1    ↓Start 
                 
                     
                 
                   −20 
                   TGGTCTGAGG  GGGCGG GCCC CAACAGCCCG AGGCGGGGTC CCCGGGGGCC CAGCGCTATA 
                 
                     
                 
             
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
         13 . The active compound as claimed in  claim 12 , containing promoter-active DNA fragments for the tissue inhibitor of metalloproteinase-3 gene, containing 
 position ≧−463 to ≦−10    or    position ≧−112 to ≦−2    or    position ≧−112 to ≦−10 of the nucleotide sequence listed in  claim 12 .    
     
     
         14 . The active compound as claimed in claims  1 - 3  for the therapy of viral infections, in which active compound the activator sequence constitutes the promoter sequence of viruses which transform the cells which they have infected and stimulate these cells to proliferate.  
     
     
         15 . The active compound as claimed in  claim 14 , containing the promoter sequence of hepatitis B virus, hepatitis C virus, herpes simplex virus I and II, human papilloma viruses, in particular HPV-16 and HPV-18, human immunodeficiency virus, in particular HIV-1, HIV-2 and HIV-3, Epstein Barr virus or human T cell leukemia virus.  
     
     
         16 . The active compound as claimed in  claim 1  for the prophylaxis of infections, containing the promoter sequence for interleukin (IL)-la or IL-1α or IL-1β, IL-1 receptor, IL-2, IL-2 receptor, inferon γ, IL-3, IL-3 receptor, IL-4, IL-4 receptor , IL-5, IL-6, interferon regulatory factor 1, IFN-γ responsive promoter, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, granulocyte macrophage colony stimulating factor (GM-CSF), M-CSF receptor, macrophage scavenger type I or type II receptor, GM-CSF receptor, granulocyte colony stimulating factor (G-CSF) or leukemia-inhibiting factor (LIF), LFA-1, MAC-1 or p150.95.  
     
     
         17 . The active compound as claimed in  claim 1  for the therapy of leukemias, containing an activator sequence (promoter sequence or enhancer sequence) which is activated by transcription factors which are formed in leukemia cells.  
     
     
         18 . The active compound as claimed in  claim 17 , containing 
 the promoter sequence for c-myc, bcl-2, bcl-1, IL-6, IL-10, TNFα or TNFβ or    the binding sequence for proteins which are formed in HOX-11, BCR-Abl, E2A-PBX-1 or PML/RARA, or    the human myc E box in single or multiple form.    
     
     
         19 . The active compound as claimed in  claim 5 , wherein the DNA sequence for the active substance encodes erythropoietin, G-CSF, GM-CSF, IL-3, LIF, IL-11 and/or thrombopoietin.  
     
     
         20 . The active compound as claimed in  claim 7 , wherein the DNA sequence for the active substance encodes 
 IFNα, IFNβ, IFNγ, IL-10, soluble IL-4 receptors, TGFβ, IL-12, soluble IL-1 receptors, soluble IL-2 receptors, soluble IL-6 receptors, IL-1 receptor antagonists, IL-1, IL-4, IL-6, IL-9, IL-13, TNFα or TNFβ, or    an immunosuppressive antibody, in particular having specificity for CD4, CD8, CD3, IL-2 receptor, IL-1 receptor or IL-4 receptor, CD2, LFA-1, CD28, CD40 linker or CD40, or    fragments of this antibody which contain VH and VL or constitute its VH and VL fragments which are connected via a linker.    
     
     
         21 . The active compound as claimed in  claim 9 , wherein the DNA sequence for an antiinflammatory substance encodes 
 an inhibitor for inflammatory interleukins or growth factors, or    an antiinflammatory interleukin, or    a growth factor which stimulates synthesis of the extracellular matrix, or    superoxide dismutase, or    a proteinase inhibitor.    
     
     
         22 . The active compound as claimed in  claim 21 , wherein 
 the inhibitor for inflammatory interleukins or growth factors is the interleukin-1 receptor antagonist, the soluble interleukin-1 receptor or the soluble tumor necrosis factor α (TNFα ) receptor, or    the antiinflammatory interleukins IL-4, IL-6 or IL-10, or    the growth factor which stimulates synthesis of the extracellular matrix, insulin-like growth factor or transforming growth factor β (TGFβ), or    constitutes the proteinase inhibitor tissue inhibitor of metalloproteinase-1 (TIMP-1), TIMP-2 or TIMP-3.    
     
     
         23 . The active compound as claimed in  claim 14 , wherein the DNA sequence for the active substance encodes 
 IFNα, IFNβ, IFNγ, TNF, in particular TNFα, IL-1 or TGFβ, or    an antibody of a specificity which inactivates the relevant virus, or    a VH and VL-containing fragment of this antibody or its VH and VL fragments which are connected via a linker, or    a rev-binding protein, in particular RBP9-27, RBP1-8U or RBP1-8D.    
     
     
         24 . The active compound as claimed in  claim 16 , wherein the DNA sequence for the active substance encodes 
 the neutralization or inactivation antigen of a virus, of a bacterium or of a parasite, or    an antiidiotype antibody, or a fragment of this antibody, whose complementarity determining regions are a copy of the protein structure or carbohydrate structure of the neutralization antigen of an infectious pathogen.    
     
     
         25 . The active compound as claimed in  claim 24 , wherein the DNA sequence encodes the antigens of influenza, HIV, rabies, HSV, RSV, parainfluenza virus, rotavirus, VZV, CMV, measles virus, HPV, HBV, HCV, HDV, HEV, HAV, Vibriocholera toxin, Borrelia burgdorferi, Heliocobacter pylori or malaria.  
     
     
         26 . The active compound as claimed in  claim 7 ,  14  and  17 , wherein the active substance is a DNA sequence for a cell cycle inhibitor.  
     
     
         27 . The active compound as claimed in  claim 26 , wherein the DNA sequence for the cell cycle inhibitor encodes 
 the retinoblastoma protein pRb/p110, or the related p107 and p130 proteins, or    the p53 protein, or    the p21 protein, the P16 protein or another cyclin-dependent kinase (cdK) inhibitor, or    the GADD45 protein, or    the bak protein, or    a cytotoxic protein, or    a cytostatic cytokine, or    an enzyme for cleaving precursors of cytostatic agents to form cytostatic agents.    
     
     
         28 . The active compound as claimed in  claim 27 , 
 wherein the DNA sequence for the retinoblastoma protein (pRb/p110) can no longer be phosphorylated as a result of the replacement of the amino acids in positions 246, 350, 601, 605, 780, 786, 787, 800 and 804, without, however, the mutated pRb/p110 forfeiting its binding activity with the large T antigen, in particular with the amino acids Thr-246, Ser-601, Ser-605, Ser-780, Ser-786, Ser-787 and Ser-800 being replaced with Ala, the amino acid Thr-350 being replaced with Arg and the amino acid Ser-804 being replaced with Glu, or    wherein the DNA sequence for the p107 protein or the P130 protein is mutated in a manner which is analogous to that in the case of the mutated pRb/p110 protein.    
     
     
         29 . The active compound as claimed in  claim 27 , wherein the DNA sequence for the p53 protein is truncated at the C terminus by removing serine 392.  
     
     
         30 . The active compound as claimed in  claim 27 , in which the DNA sequence encodes the cytotoxic protein or cytostatic cytokine perforin, granzyme, IL-2, IL-4, IFNα, IFNβ, IFNγ, TNFα, TNFβ, TGFβ or oncostatin M.  
     
     
         31 . The active compound as claimed in  claim 27 , wherein the enzyme is a herpes simplex virus thymidine kinase, cytosine deaminase, varicella zoster virus thymidine kinase, nitroreductase, β-glucuronidase (in particular a human, vegetable or bacterial β-glucuronidase), carboxypeptidase (preferably from Pseudomonas), lactamase (preferably from Bacillus cereus), pyroglutamate aminopeptidase, D-aminopeptidase, oxidase, peroxidase, phosphatase, hydroxynitrile lyase, protease, esterase or a glycosidase, with the homologous signal sequence, or, for ensuring improved cellular secretion, a heterologous signal sequence, being used.  
     
     
         32 . The active compound as claimed in  claim 31 , wherein lysosomal storage is decreased, and extracellular secretion is increased, by means of point mutations in the DNA sequence of the enzyme.  
     
     
         33 . The active compound as claimed in claims  19 - 32 , which contains the DNA sequences of several identical or different active substances, with two DNA sequences being connected to each other through a DNA sequence for the internal ribosome entry site.  
     
     
         34 . The active compound as claimed in  claim 33 , wherein one active substance encodes the antigen, or the antiidiotype antibody for this antigen, of an infectious pathogen and the second active substance encodes a cytokine or a cytokine receptor, in particular 
 TGFβ, IFNα, IFNβ, IFNγ, IL-12 or soluble IL-4 receptors, or    IL-4, IL-6, LIF, IL-9, IL-10, IL-13, TNFα or TNFβ, or    IL-1, IL-2, M-CSF or GM-CSF.    
     
     
         35 . The active compound as claimed in claims  1 - 34 , which is inserted into a vector.  
     
     
         36 . The active compound as claimed in  claim 35 , wherein the vector is a virus.  
     
     
         37 . The active compound as claimed in  claim 36 , wherein the virus is a retrovirus, adenovirus, adenoassociated virus, herpes simplex virus or vaccinia virus.  
     
     
         38 . The active compound as claimed in claims  1 - 34 , which is inserted into a plasmid.  
     
     
         39 . The active compound as claimed in claims  35 - 38 , which is prepared in a colloidal dispersion system.  
     
     
         40 . The active compound as claimed in  claim 39 , wherein the colloidal dispersion system is liposomes.  
     
     
         41 . The active compound as claimed in  claim 39 , wherein the colloidal dispersion system is polylysine ligands.  
     
     
         42 . The active compound as claimed in claims  1 - 41 , which is supplemented with a ligand which binds to membrane structures of hematopoietic cells, to activated lymphocytes, to activated macrophages, to activated synovial cells, to virus-infected cells or to leukemia cells.  
     
     
         43 . The active compound as claimed in  claim 42 , wherein the ligand 
 is a polyclonal or monoclonal antibody, or an antibody fragment thereof, which specifically binds, by its variable domains, to the cell membrane, or    is a polyclonal or monoclonal antibody, or an antibody fragment thereof, which binds, by its constant domains, to Fc receptors on the cell membrane, or    is a cytokine or growth factor, or a fragment or a constituent sequence thereof, which binds to the corresponding receptors on the cell membrane, or    is a ligand containing a terminal galactose, which ligand binds to the asialoglycoprotein receptor, or    is a transferrin, or fragment thereof, which binds to the transferrin receptor, or    is an insulin, or fragment thereof, which binds to the insulin receptor, or    is a ligand which contains a terminal mannose, which ligand binds to the mannose 6-phosphate receptor.    
     
     
         44 . The active compound as claimed in  claim 43 , wherein the cell membrane structures are receptors for cytokines, growth factors, interferons or chemokines, in particular receptors for stem cell factor, IL-1, IL-2, IL-3, IL-4, IL-6, IL-8, IL-10, interferon α, interferon β, interferon γ, LIF, GM-CSF, G-CSF, TNF∝, EGF, FGF, TGFβ, PDGF or IGF.  
     
     
         45 . The active compound as claimed in  claim 21 , wherein the membrane structure of synovial cells or inflammatory cells is vimentin, fibronectin, IL-1 receptor, IL-2 receptor, TNFα receptor, IL-4 receptor, IL-10 receptor, IGF receptor, TGFβ receptor of mannose 6-phosphate receptor.  
     
     
         46 . The active compound as claimed in  claim 43 , wherein the cell membrane structures are antigens which are elicited by infection with viruses, in particular by HBV, HCV, HAV, HSV, HPV, EBV, HTLV or HIV.  
     
     
         47 . The active compound as claimed in  claim 43 , wherein the membrane structures of leukaemia cells are receptors for IFNα, IL-2, FGF, TGFβ or retinoids.  
     
     
         48 . The active compound as claimed in claims  1 - 47 , wherein the vector is mixed with a cytokine, a cytokine receptor or an adjuvant, or with substances which facilitate uptake and immunization by way of the mucous membrane.  
     
     
         49 . The active compound as claimed in  claim 48 , wherein 
 IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL-12, IFNγ, M-CSF, GM-CSF and/or IL-4 receptor, or    liposomes, biodegradable polymers, muramyl dipeptides, lipopolysaccharides, lipid A, or Al (OH) 3  or Ca(OH) 3      were admixed.    
     
     
         50 . The active compound as claimed in claims  1 - 49 , in a pharmaceutical preparation for injection into a tissue, such as muscle, connective tissue, liver, kidney, spleen, lung or skin, for local application to the skin or to mucous membranes, for injection into body cavities, such as joints, pleural space, peritoneal space or subarachinoid space, or for injection into the blood vessel system, such as intraarterial or intravenous injection, or for oral uptake.