Expression of surface layer proteins

Abstract

A host cell which is provided with a S-layer comprising a fusion polypeptide consisting essentially of: (a) at least sufficient of a S-layer protein for a S-layer composed thereof to assemble, and (b) a heterologous polypeptide which is fused to either the carboxy terminus of (a) or the amino terminus of (a) and which is thereby presented on the outer surface of the said cell; can be used as a vaccine, for screening for proteins and antigens and as a support for immobilizing an enzyme, peptide or antigen.

1 - A host cell which is provided with a S-layer comprising a fusion polypeptide having: 
 (a) at least sufficient of a S-layer protein for a S-layer composed thereof to assemble, and    (b) a heterologous polypeptide which is fused to either the carboxy terminus of (a) or the amino terminus of (a) and which is thereby presented on the outer surface of the said cell.    
     
     
         2 - A cell according to  claim 1  which is a bacterium of the genus Bacillus.  
     
     
         3 - A cell according to  claim 2  wherein the bacterium is  B. sphaericus  P-1 (LMG P-13855).  
     
     
         4 - A cell according to  claim 1 , wherein the heterologous polypeptide is fused to either the carboxy terminus or the amino terminus of the most N-terminal 41% or more amino acid residues of a S-layer protein.  
     
     
         5 - A cell according to  claim 1 , wherein the S-layer protein is derived from  B. sphaericus.    
     
     
         6 - A cell according to  claim 1 , wherein the heterologous polypeptide is an antigenic peptide.  
     
     
         7 - A cell according to  claim 6 , wherein the heterologous polypeptide comprises an antigenic determinant of a pathogen selected from a virus, bacterium, fungus, yeast and parasite.  
     
     
         8 - A cell according to  claim 6 , wherein the heterologous polypeptide is selected from the group consisting of P69 antigen of  Bordetella pertussis , pertussis toxin, a subunit of pertussis toxin, tetanus toxin fragment C,  E. coli  heat labile toxin B subunit and an  E. coli  K88 antigen.  
     
     
         9 - Sacculi derived from a host cell according to  claim 1 .  
     
     
         10 - A pharmaceutical or veterinary composition comprising the host cell of  claim 1  and a pharmaceutically or veterinarily acceptable carrier or diluent.  
     
     
         11 - A vaccine comprising the host cell of  claim 6  and an acceptable carrier or diluent therefor.  
     
     
         12 - A recombinant DNA molecule comprised of a promoter operably linked to a coding sequence which encodes a signal peptide and a fusion polypeptide, the signal peptide being capable of directing the said fusion polypeptide to be presented on the surface of a host cell in which expression occurs and the fusion polypeptide being of a heterologous polypeptide fused to either the carboxy terminus or the amino terminus of at least sufficient of a S-layer protein for a S-layer composed thereof to assemble.  
     
     
         13 - A molecule according to  claim 12 , wherein the promoter is a promoter for a S-layer protein from a Bacillus bacterium.  
     
     
         14 - A molecule according to  claim 13 , wherein the promoter is the P1 promoter of  B. sphaericus  P-1 (LMG P-13855).  
     
     
         15 - A molecule according to  claim 12 , wherein the signal peptide is the signal peptide for the S-layer protein of which an appropriate portion is incorporated in the fusion polypeptide.  
     
     
         16 - A molecule according to  claim 12 , wherein the signal peptide is a signal peptide for a S-layer protein of a Bacillus bacterium.  
     
     
         17 - A molecule according to  claim 12  which is an expression vector.  
     
     
         18 - A molecule according to  claim 17 , wherein the vector is a plasmid.  
     
     
         19 - A host cell having the recombinant DNA molecule of  claim 12 .  
     
     
         20 - A host cell according to  claim 19  which has been transformed with the vector of  claim 17 .  
     
     
         21 - A cell according to  claim 19  which is a gram-positive bacterium.  
     
     
         22 - A cell according to  claim 19  which is a bacterium of the genus Bacillus.  
     
     
         23 - A cell according to  claim 22  wherein the bacterium is  B. sphaericus  P-1 (LMG P-13855).  
     
     
         24 - A process for the preparation of a host cell provided with a S-layer comprising a fusion polypeptide, which process comprises: 
 (i) providing a suitable host cell incorporating a recombinant DNA molecule having a promoter operably linked to a coding sequence which encodes a signal peptide and a fusion polypeptide, the signal peptide being capable of directing the said fusion polypeptide to be presented on the surface of the said host cell and the fusion polypeptide being a heterologous polypeptide fused to either the carboxy terminus or the amino terminus of at least sufficient of a S-layer protein for a S-layer composed thereof to assemble; and    (ii) culturing the said host cell so that the said fusion polypeptide is expressed and a S-layer having the fusion polypeptide is formed on the surface of the said host cell, the heterologous polypeptide thereby being presented on the outer surface of the said host cell.    
     
     
         25 - A process according to  claim 24 , which comprises: 
 (a) providing an intermediate vector in which the coding sequence of an internal portion of the native S-layer protein of the said host cell is translationally fused to the 3′-end thereof the coding sequence for the heterologous polypeptide and in which the said coding sequences are provided upstream of a promotorless selectable marker gene such that they form a translational or transcriptional fusion therewith;    (b) transforming the said host cell with the intermediate vector;    (c) selecting a transformed host cell which has a S-layer comprising the said fusion polypeptide.    
     
     
         26 - A process according to  claim 24  which comprises: 
 (a) fusing to a promoter a S-layer protein coding sequence coding for the signal peptide and at least sufficient of the amino-terminal portion of a S-layer protein for a S-layer composed thereof to assemble on the surface of the host cell, and fusing a peptide coding sequence coding for the heterologous polypeptide to the 3′-end of the S-layer protein coding sequence, whereby a recombinant DNA molecule for the expression and presentation of the fusion polypeptide is prepared;  
 (b) inserting the recombinant DNA molecule into a suitable vector, whereby a recombinant DNA vector is prepared;  
 (c) transforming a suitable host cell with the recombinant DNA vector, whereby a transformed host cell having the recombinant DNA molecule is provided; and  
 (d) culturing the transformed host cell, whereby the fusion polypeptide is expressed and a S-layer comprising the fusion polypeptide is assembled on the host cell wall.  
 
     
     
         27 - A promoter having a −35 region of the sequence TTGAAT and a −10 region of the sequence TATATT.  
     
     
         28 - A promoter according to  claim 27 , having the sequence CTAAATTATGTCCCAATGCTTGAATTTCGGAAAAGATAGTGTTAT ATTATTGT.  
     
     
         29 - A promoter having a −35 region of the sequence CTTGGTT and a −10 region of the sequence TATAAT.  
     
     
         30 - A promoter according to  claim 29 , having the sequence TCCAGAAAATGCTTGGTTATTATTGAGAGTAAGGTATAATAGGTA.  
     
     
         31 - A promoter having a −35 region of the sequence ATTACGGGA and a −10 region of the sequence TTTAGT.  
     
     
         32 - A promoter according to  claim 31 , having the sequence AAAATATTACGGGAGTCTTTAATTTTGACAATTTAGTAACCAT.  
     
     
         33 - The promoter according to  claim 27 , having the sequence from nucleotide 52 to 353 shown in FIG. 10.  
     
     
         34 - The promoter according to  claim 29 , having the sequence from nucleotide 52 to 353 shown in FIG. 10.  
     
     
         35 - The promoter according to  claim 31 , having the sequence from nucleotide 52 to 353 shown in FIG. 10.  
     
     
         36 - An expression vector comprised of a promoter as defined in any one of  claim 27  and a downstream cloning site into which a DNA sequence encoding a heterologous protein may be cloned such that the promoter is operably linked to the said sequence.  
     
     
         37 - An expression vector comprised of a promoter as defined in any one of  claim 29  and a downstream cloning site into which a DNA sequence encoding a heterologous protein may be cloned such that the promoter is operably linked to the said sequence.  
     
     
         38 - An expression vector comprised of a promoter as defined in any one of  claim 31  and a downstream cloning site into which a DNA sequence encoding a heterologous protein may be cloned such that the promoter is operably linked to the said sequence.  
     
     
         39 - An expression vector having a promoter as defined in any one of  claim 27  operably linked to a DNA sequence encoding a heterologous protein.  
     
     
         40 - An expression vector having a promoter as defined in any one of  claim 29  operably linked to a DNA sequence encoding a heterologous protein.  
     
     
         41 - An expression vector having a promoter as defined in any one of  claim 31  operably linked to a DNA sequence encoding a heterologous protein.  
     
     
         42 - A DNA fragment comprising a promoter according to any one of claims  27  operably linked to a DNA sequence encoding a heterologous protein.  
     
     
         43 - A DNA fragment comprising a promoter according to any one of claims  29  operably linked to a DNA sequence encoding a heterologous protein.  
     
     
         44 - A DNA fragment comprising a promoter according to any one of claims  31  operably linked to a DNA sequence encoding a heterologous protein.  
     
     
         45 - A host cell transformed with an expression vector as defined in  claim 39 .  
     
     
         46 - A host cell transformed with an expression vector as defined in  claim 40 .  
     
     
         47 - A host cell transformed with an expression vector as defined in  claim 41 .  
     
     
         48 - A process for the preparation of a heterologous protein, which process comprises culturing a transformed host cell according to  claim 45  and obtaining the heterologous protein thus expressed.  
     
     
         49 - A process for the preparation of a heterologous protein, which process comprises culturing a transformed host cell according to  claim 46  and obtaining the heterologous protein thus expressed.  
     
     
         50 - A process for the preparation of a heterologous protein, which process comprises culturing a transformed host cell according to  claim 47  and obtaining the heterologous protein thus expressed.  
     
     
         51 - A pharmaceutical or veterinary composition comprising a pharmaceutically or veterinarily acceptable carrier or diluent and, as active ingredient, a physiologically active heterologous protein which has been obtained by the process of  claim 48 .  
     
     
         52 - A pharmaceutical or veterinary composition comprising a pharmaceutically or veterinarily acceptable carrier or diluent and, as active ingredient, a physiologically active heterologous protein which has been obtained by the process of  claim 49 .  
     
     
         53 - A pharmaceutical or veterinary composition comprising a pharmaceutically or veterinarily acceptable carrier or diluent and, as active ingredient, a physiologically active heterologous protein which has been obtained by the process of  claim 50 .  
     
     
         54 - A process of transforming  B. sphaericus  P-1 cells with DNA, which process comprises harvesting  B. sphaericus  P-1 cells at the late stationary growth phase, mixing the harvested cells with the DNA and effecting electroporation to cause entry of the DNA into the said cells.  
     
     
         55 - Use of the host cell of  claim 1  for immobilisation purposes.  
     
     
         56 - Use of the host cell of  claim 1  for screening purposes.