Method for detecting aflatoxin B1 based on fluorescent copper nanoparticles

Abstract

Disclosed is a method for detecting aflatoxin B1 based on fluorescent copper nanoparticles, belonging to the technical fields of analytical chemistry, materials science and nano biosensing. In the disclosure, β-CD@DNA-Cu NMs are prepared by using Y-shaped DNA as a template, ascorbic acid as a reducing agent and β-CD as a fluorescence stabilizing and enhancing agent. Then, a ratiometric fluorescent probe is constructed based on the β-CD@DNA-Cu NMs. Finally, the detection of AFB1 with high sensitivity, high selectivity and high accuracy is achieved by using the fluorescent probe. According to the method of the disclosure, in linear ranges of 0.03-10 ppb and 10-18 ppb, a ratio value of I433 nm/I650 nm and a concentration of AFB1 exhibit a good linear relationship respectively, and a limit of detection is 0.012 ppb (S/N=3). Metal ions Ca2+ may be replaced with Yb3+, Y3+, Er3+ and Pt2+, which are also suitable for increasing sensitivity of AFB1 in rice.

What is claimed is: 
     
       1. A method for preparing fluorescent copper nanoparticles β-CD@DNA-Cu NMs, comprising the following steps:
 (1) preparing of DNA-Cu NMs by 
 mixing a template strand Y-shaped DNA solution and an ascorbic acid solution uniformly, then adding a cupric acetate solution, and mixing the mixture uniformly to obtain a DNA-Cu NMs solution; and 
 (2) preparing of β-CD modified DNA-Cu NMs by 
 mixing the DNA-Cu NMs solution obtained in step (1) and a β-CD solution uniformly, and performing ultrafiltration to obtain the β-CD@DNA-Cu NMs. 
 
     
     
       2. The method according to  claim 1 , wherein the β-CD solution in step (2) has a concentration of 0.5-5 mM. 
     
     
       3. The method according to  claim 1 , wherein further comprising preparing the template strand Y-shaped DNA in step (1) by:
 mixing three oligonucleotide strands (Y 0a , Y 0b , Y 0c ) equally in an MOPS buffer to obtain a mixed solution; then heating the mixed solution to 90° C., and after 5 min of denaturation, slowly cooling the mixed solution to room temperature to obtain the Y-shaped DNA; and storing the Y-shaped DNA solution in a refrigerator at −18° C., wherein the MOPS buffer has a concentration of 5-20 mM, a concentration of NaAc is 75-300 mM, a concentration of MgCl 2  is 1-10 mM, and a pH is 6.5-8.5; a DNA sequence of Y 0a  is set forth in SEQ ID NO.1: CCTGTCTGCCTAATGTGCGTCGTAAG; a DNA sequence of Y 0b  is set forth in SEQ ID NO.2: CTTACGACGCACAAGGAGATCATGAG; and a DNA sequence of Y 0c  is set forth SEQ ID NO.3: CTCATGATCTCCTTTAGGCAGACAGG. 
 
     
     
       4. A method for preparing a β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor based on the fluorescent copper nanoparticles β-CD@DNA-Cu NMs prepared by the method according to  claim 1 , comprising the following steps:
 adding a solution of the fluorescent copper nanoparticles β-CD@DNA-Cu NMs prepared by the method according to  claim 1  to an AFB1 solution, shaking the mixture at 300-500 rpm for 0.5-1.5 min, and mixing the mixture uniformly to obtain the β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor, wherein a concentration of the β-CD@DNA-Cu NMs is 200 μM-2 mM, and the AFB1 solution has a concentration of 0.05-18 ppb. 
 
     
     
       5. The method according to  claim 4 , wherein a volume ratio of the solution of β-CD@DNA-Cu NMs to the AFB1 solution is 1:8-10. 
     
     
       6. The method according to  claim 4 , wherein the AFB1 solution is obtained by dissolving AFB1 in 1-40% methanol/water (V/V). 
     
     
       7. A method for preparing a β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 based on the β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor prepared by the method according to  claim 4 , comprising the following steps:
 mixing an AFB1 solution and a metal ions M solution uniformly to obtain an M-AFB1 mixed solution; and then adding a solution of the fluorescent copper nanoparticles β-CD@DNA-Cu NMs prepared by the method according to  claim 1  to the M-AFB1 mixed solution, shaking the mixture at 300-500 rpm for 0.5-1.5 min, and mixing the mixture uniformly to obtain the β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor. 
 
     
     
       8. The method according to  claim 7 , wherein the AFB1 solution has a concentration of 0.05-18 ppb, the metal ions M solution has a concentration of 1-50 mM, and the metal ions M comprise Pt 2+ , Yb 3+ , Er 3+ , Y 3+ , Ca 2+  and Hg 2+ . 
     
     
       9. The method according to  claim 7 , wherein metal compounds corresponding to the metal ions M comprise: tetrachloroplatinic acid, ytterbium chloride hexahydrate, erbium chloride, yttrium chloride hexahydrate, anhydrous calcium chloride and an Hg 2+  standard solution. 
     
     
       10. The method according to  claim 7 , wherein a volume ratio of the AFB1 solution to the metal ions M solution is 7-9:1. 
     
     
       11. The method according to  claim 7 , wherein a volume ratio of the solution of β-CD@DNA-Cu NMs to the M-AFB1 mixed solution is 1:9. 
     
     
       12. A β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 prepared by the method according to  claim 7 . 
     
     
       13. A method for detecting AFB1 based on the β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 according to  claim 12 , comprising the following steps:
 (1) pretreatment of sample: 
 adding an extraction solvent to a sample to be tested to carry out extraction, and carrying out centrifugation and filtration to obtain a sample to be analyzed; and 
 (2) testing: 
 carrying out fluorescence detection on the sample to be analyzed to obtain fluorescence values at 433 nm and 650 nm, I 433  nm and I 650  nm, and then substituting the fluorescence values into an AFB1 standard curve to obtain a concentration of AFB1 in the sample to be tested. 
 
     
     
       14. The method according to  claim 13 , wherein the extraction solvent in step (1) is one of methanol/water, ethanol/water or acetonitrile/water with a volume fraction of 40%. 
     
     
       15. The method according to  claim 13 , wherein a ratio of the sample to be tested to the extraction solvent in step (1) is 1:3-5 in g/mL. 
     
     
       16. The method according to  claim 13 , wherein the AFB1 standard curve in step (2) is I 433  nm/I 650  nm=0.0627C−0.0068, R 2 =0.9963, and a linear range is 0.03-10 ppb; and I 433  nm/I 650  nm=0.4825C−4.7038, R 2 =0.9736, and a limit of detection is 0.012 ppb (S/N=3), wherein I 433  nm is the maximum fluorescence value of AFB1, I 650  nm is the maximum fluorescence value of β-CD@DNA-Cu NMs, and the ratio value of I 433  nm/I 650  nm represents the detection result; and C is the concentration of AFB1.