US11473108B2ActiveUtilityA1

Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Assignee: UNIV CALIFORNIAPriority: May 25, 2012Filed: Mar 24, 2022Granted: Oct 18, 2022
Est. expiryMay 25, 2032(~5.8 yrs left)· nominal 20-yr term from priority
H10P 14/6512H10P 14/20C12N 2310/33C12N 2800/80C12N 9/22C07K 2319/71C12N 15/90A61K 38/465C12N 15/63C12N 2310/13C12N 15/102A01H 6/4684C12N 2310/3519A61P 35/00C12N 15/902C12N 15/70A61P 31/12C12N 2310/20C12N 2310/32C12N 2310/531C12N 2310/11C12Y 301/04A01K 67/027C12N 15/907C12N 15/113C12N 2310/14C12N 2310/31C07K 2319/85A61K 48/00A61P 43/00C12N 15/111C12Q 1/686C12N 15/746C12N 5/10A61P 31/04A61P 31/00Y02A50/30H10H 20/0137C12N 9/226
98
PatentIndex Score
2
Cited by
2,236
References
30
Claims

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims

exact text as granted — not AI-modified
What is claimed is: 
     
       1. A composition comprising a single molecule DNA-targeting RNA, or a nucleic acid encoding said single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
 (i) a targeter-RNA comprising (a) a DNA-targeting sequence, which is a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (b) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and 
 (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded duplex, 
 wherein (i) and (ii) are covalently linked by intervening nucleotides, and 
 wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. 
 
     
     
       2. The composition of  claim 1 , wherein the DNA-targeting sequence is 18 to 30 nucleotides long. 
     
     
       3. The composition of  claim 1 , wherein said intervening nucleotides are 3-5 nucleotides. 
     
     
       4. The composition of  claim 1 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence 
       
         
           
                 
               
                   (SEQ ID NO: 432) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCG 
                 
                     
                 
                   AGUCGGUGCUUUUUUU 
                 
                     
                 
                   or the 26 nucleotide tracrRNA sequence 
                 
                   (SEQ ID NO: 441) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCG. 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
       5. The composition of  claim 4 , wherein the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679). 
     
     
       6. The composition of  claim 1 , comprising said single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more phosphorothioates, one or more inverted polarity linkages, one or more abasic nucleoside linkages, one or more locked nucleic acids (LNAs), one or more 2′-substituted sugar moieties, one or more 2′-O-methoxyethyl modified sugar moieties, one or more 2′-O-methyl modified sugar moieties, one or more 2′-O-(2-methoxyethyl) modified sugar moieties, one or more 2′-fluoro modified sugar moieties, one or more 2′-dimethylaminooxyethoxy modified sugar moieties, one or more 2′-dimethylaminoethoxyethoxy modified sugar moieties, one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, one or more cyclohexenyl nucleic acids (CeNAs), or any combination thereof. 
     
     
       7. The composition of  claim 1 , further comprising the Cas9 protein or a nucleic acid encoding the Cas9 protein. 
     
     
       8. The composition of  claim 7 , comprising a protein-RNA complex comprising the Cas9 protein and the single molecule DNA-targeting RNA. 
     
     
       9. A composition comprising a single molecule DNA-targeting RNA, or a nucleic acid encoding said single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
 (i) a targeter-RNA comprising (a) a DNA-targeting sequence, which is a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (b) a second nucleotide sequence that hybridizes with an activator-RNA; and 
 (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded duplex, 
 wherein (i) and (ii) are covalently linked by intervening nucleotides, 
 wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and guiding the complex to the target sequence to cleave the target DNA, and 
 wherein: 
 (A) the composition is lyophilized; or 
 (B) the composition comprises a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, a complexing agent, or any combination thereof. 
 
     
     
       10. The composition of  claim 9 , wherein the composition comprises the nuclease inhibitor. 
     
     
       11. The composition of  claim 9 , wherein the composition is lyophilized. 
     
     
       12. The composition of  claim 9 , wherein the Cas9 protein is a  Streptococcus pyogenes  Cas9. 
     
     
       13. The composition of  claim 9 , further comprising the Cas9 protein or a nucleic encoding the Cas9 protein. 
     
     
       14. The composition of  claim 13 , wherein the Cas9 protein comprises one or more mutations in a RuvC domain and/or an HNH domain. 
     
     
       15. The composition of  claim 9 , wherein the DNA-targeting sequence is 18 to 30 nucleotides long. 
     
     
       16. The composition of  claim 9 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence 
       
         
           
                 
               
                   (SEQ ID NO: 432) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCG 
                 
                     
                 
                   AGUCGGUGCUUUUUUU 
                 
                     
                 
                   or the 26 nucleotide tracrRNA sequence 
                 
                   (SEQ ID NO: 441) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCG. 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
       17. The composition of  claim 16 , wherein the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679). 
     
     
       18. A composition comprising a single molecule DNA-targeting RNA, or a nucleic acid encoding said single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
 (i) a targeter-RNA comprising (a) a DNA-targeting sequence, which is a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (b) a second nucleotide sequence that hybridizes with an activator-RNA; and 
 (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded duplex, 
 wherein (i) and (ii) are covalently linked by 3-20 intervening nucleotides, and 
 wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and guiding the complex to the target sequence to cleave the target DNA. 
 
     
     
       19. The composition of  claim 18 , wherein the DNA-targeting sequence is 18 to 30 nucleotides long. 
     
     
       20. The composition of  claim 18 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence 
       
         
           
                 
               
                   (SEQ ID NO: 432) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCG 
                 
                     
                 
                   AGUCGGUGCUUUUUUU 
                 
                     
                 
                   or the 26 nucleotide tracrRNA sequence 
                 
                   (SEQ ID NO: 441) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCG. 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
       21. The composition of  claim 20 , wherein the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679). 
     
     
       22. The composition of  claim 18 , wherein the composition comprises said Cas9 protein or a nucleic encoding the Cas9 protein. 
     
     
       23. The composition of  claim 22 , wherein the Cas9 protein is a  Streptococcus pyogenes  Cas9. 
     
     
       24. The composition of  claim 22 , comprising a protein-RNA complex comprising the Cas9 protein and the single molecule DNA-targeting RNA. 
     
     
       25. A composition comprising:
 a nucleic acid that comprises a nucleotide sequence encoding a single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order: 
 (i) a targeter-RNA comprising (a) a DNA-targeting sequence, which is a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (b) a second nucleotide sequence that hybridizes with an activator-RNA; and 
 (ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded duplex, 
 wherein (i) and (ii) are covalently linked by intervening nucleotides, and 
 wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and guiding the complex to the target sequence to cleave the target DNA, 
 wherein the nucleotide sequence encoding a single molecule DNA-targeting RNA is operably linked to a heterologous promoter. 
 
     
     
       26. The composition of  claim 25 , wherein said nucleic acid is a plasmid, a cosmid, a minicircle, a phage, or a viral vector. 
     
     
       27. The composition of  claim 25 , wherein said nucleic acid is a retroviral, lentiviral, adenoviral, adeno-associated, or herpes simplex virus vector. 
     
     
       28. The composition of  claim 25 , wherein the heterologous promoter is an inducible promoter. 
     
     
       29. The composition of  claim 25 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence 
       
         
           
                 
               
                   (SEQ ID NO: 432) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCG 
                 
                     
                 
                   AGUCGGUGCUUUUUUU 
                 
                     
                 
                   or the 26 nucleotide tracrRNA sequence 
                 
                   (SEQ ID NO: 441) 
                 
                   UAGCAAGUUAAAAUAAGGCUAGUCCG. 
                 
             
                
                
                
                
                
                
                
                
               
            
           
         
       
     
     
       30. The composition of  claim 29 , wherein the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679).

Join the waitlist — get patent alerts

Track US11473108B2 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.