US10907157B2ActiveUtilityA1
Agents useful in treating facioscapulohumeral muscular dystrophy
Est. expirySep 2, 2030(~4.1 yrs left)· nominal 20-yr term from priority
C12N 15/113C12N 2310/3233C12N 2310/14C12N 2310/11C12N 2320/33C12N 2310/321A61P 35/00C12N 15/111C12N 2310/315C12N 2310/531C12N 2310/3513C12N 2310/3521
93
PatentIndex Score
15
Cited by
59
References
30
Claims
Abstract
Antisense agents and RNA interference agents useful for treating diseases and conditions the treatment of which can benefit from reducing the expression of double homeobox 4 and/or double homeobox 4c, more particularly facioscapulohumeral muscular dystrophy, are described. Methods, uses and further products employing such agents are also described.
Claims
exact text as granted — not AI-modifiedWhat is claimed is:
1. An oligonucleotide of 20 to 30 nucleotides in length that comprises at least 20 consecutive nucleotides that are complementary to the nucleotide sequence set forth as SEQ ID NO: 69 (AGTTCAGAGATATATTAAAATGCCC), wherein the oligonucleotide comprises one or more modifications.
2. The oligonucleotide of claim 1 , wherein the oligonucleotide is perfectly complementary to the nucleotide sequence set forth as SEQ ID NO: 69 (AGTTCAGAGATATATTAAAATGCCC).
3. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO: 65 (GGGCAUUUUAAUAUAUCUCUGAACU).
4. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises at least 20 consecutive nucleotides of SEQ ID NO: 65 (GGGCAUUUUAAUAUAUCUCUGAACU), wherein one or more uracil bases are replaced by thymine bases.
5. The oligonucleotide of claim 1 , wherein the oligonucleotide has the nucleotide sequence set forth as SEQ ID NO: 65 (GGGCAUUUUAAUAUAUCUCUGAACU), wherein one or more uracil bases are replaced by thymine bases.
6. The oligonucleotide of claim 1 , wherein the oligonucleotide has the nucleotide sequence set forth as SEQ ID NO: 65 (GGGCAUUUUAAUAUAUCUCUGAACU), wherein each uracil bases is replaced by a thymine base.
7. The oligonucleotide of claim 1 , wherein each of the one or more modifications comprises a phosphorodiamidate morpholino oligomer (PMO) backbone modification.
8. The oligonucleotide of claim 7 , wherein each of the one or more modifications is a PMO backbone modification.
9. The oligonucleotide of claim 8 , wherein the oligonucleotide is a fully modified PMO.
10. The oligonucleotide of claim 1 , wherein the oligonucleotide is covalently linked to a moiety that enhances the cellular uptake of the oligonucleotide.
11. The oligonucleotide of claim 10 , wherein the moiety enhances uptake of the oligonucleotide into muscle cells.
12. The oligonucleotide of claim 11 , wherein the moiety is a cell-penetrating peptide.
13. The oligonucleotide of claim 9 , wherein the oligonucleotide is covalently linked to a moiety that enhances the cellular uptake of the oligonucleotide.
14. The oligonucleotide of claim 13 , wherein the moiety enhances uptake of the oligonucleotide into muscle cells.
15. A method for reducing the expression of DUX4 in a cell, comprising delivering the oligonucleotide of claim 1 to the cell in an amount effective to reduce expression of DUX4 in the cell.
16. The method of claim 15 , wherein the cell is in vitro.
17. The method of claim 15 , wherein the cell is in a subject.
18. The method of claim 15 , wherein the cell is a muscle cell.
19. The method of claim 18 , wherein the muscle cell is a muscle cell of a subject having facioscapulohumeral muscular dystrophy (FSHD).
20. The method of claim 19 , wherein the subject is a human subject.
21. A method for reducing the expression of DUX4 in a cell, the method comprising delivering the oligonucleotide of claim 9 to the cell in an amount effective to reduce expression of DUX4 in the cell.
22. The method of claim 21 , wherein the cell is in vitro.
23. The method of claim 21 , wherein the cell is in a subject.
24. The method of claim 21 , wherein the cell is a muscle cell.
25. The method of claim 24 , wherein the muscle cell is a muscle cell of a subject having facioscapulohumeral muscular dystrophy (FSHD).
26. The method of claim 25 , wherein the subject is a human subject.
27. The method of claim 21 , wherein the oligonucleotide is covalently linked to a moiety that enhances the cellular uptake of the oligonucleotide.
28. The method of claim 27 , wherein the moiety enhances uptake of the oligonucleotide into muscle cells.
29. The oligonucleotide of claim 1 , wherein the one or more modifications comprises a 2′-O-methoxyethyl sugar modification.
30. The oligonucleotide of claim 29 , wherein each of the one or more modifications is a 2′-O-methoxyethyl sugar modification.Join the waitlist — get patent alerts
Track US10907157B2 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.