US10767179B2ActiveUtilityA1
MicroRNA composition for the treatment of neuroblastoma
Est. expiryFeb 13, 2034(~7.6 yrs left)· nominal 20-yr term from priority
Inventors:Liqin Du
C12N 2310/141A61K 45/06C12N 15/113A61K 31/713A61K 2300/00
42
PatentIndex Score
0
Cited by
95
References
3
Claims
Abstract
Certain embodiments are directed to methods of identifying neuroblastoma differentiation-inducing compounds or agent and their use in treating neuroblastoma.
Claims
exact text as granted — not AI-modifiedThe invention claimed is:
1. A synthetic microRNA mimic comprising a double stranded RNA comprising (i) a first RNA component comprising a seed sequence of aaggcac (SEQ ID NO:3) and a mature sequence that is at least 90% identical to uaaggcacccuucugaguaga (SEQ ID NO:1), and (ii) a second RNA component comprising a complement of the first RNA component.
2. The synthetic microRNA mimic of claim 1 , wherein the mimic is at most 150 nucleotides in length.
3. The synthetic microRNA mimic of claim 1 , wherein the mimic is 30 to 130 nucleotides in length.Join the waitlist — get patent alerts
Track US10767179B2 — get alerts on status changes and closely related new filings.
We store only your email — no account needed. See our privacy policy.