US10767179B2ActiveUtilityA1

MicroRNA composition for the treatment of neuroblastoma

Assignee: DU LIQINPriority: Feb 13, 2014Filed: Oct 1, 2018Granted: Sep 8, 2020
Est. expiryFeb 13, 2034(~7.6 yrs left)· nominal 20-yr term from priority
Inventors:Liqin Du
C12N 2310/141A61K 45/06C12N 15/113A61K 31/713A61K 2300/00
42
PatentIndex Score
0
Cited by
95
References
3
Claims

Abstract

Certain embodiments are directed to methods of identifying neuroblastoma differentiation-inducing compounds or agent and their use in treating neuroblastoma.

Claims

exact text as granted — not AI-modified
The invention claimed is: 
     
       1. A synthetic microRNA mimic comprising a double stranded RNA comprising (i) a first RNA component comprising a seed sequence of aaggcac (SEQ ID NO:3) and a mature sequence that is at least 90% identical to uaaggcacccuucugaguaga (SEQ ID NO:1), and (ii) a second RNA component comprising a complement of the first RNA component. 
     
     
       2. The synthetic microRNA mimic of  claim 1 , wherein the mimic is at most 150 nucleotides in length. 
     
     
       3. The synthetic microRNA mimic of  claim 1 , wherein the mimic is 30 to 130 nucleotides in length.

Join the waitlist — get patent alerts

Track US10767179B2 — get alerts on status changes and closely related new filings.

We store only your email — no account needed. See our privacy policy.